• Haiku 425 – 429

Etiquetas

• Haiku 425 – 429

[425]

Corren las niñas
buscando flores blancas;
entre luciérnagas.

Corren las niñas buscando flores blancas; entre luciérnagas.

[426]

Abundan flores
en el jardín del templo,
entre las tumbas.

Abundan flores en el jardín del templo, entre las tumbas.

[427]

Con nieve fría
las columnas del templo;
ofrecen calor.

Con nieve fría las columnas del templo; ofrecen calor.

[428]

Gotea el agua
tras la lluvia torrencial;
beben los ciervos.

Gotea el agua tras la lluvia torrencial; beben los ciervos.

[429]

Las crías pían
exigiendo comida;
los padres cazan.

Las crías pían exigiendo comida; los padres cazan.

 

Luis J. Goróstegui
#haiku

________________________________________

Anuncios

204. Cuestión de perspectiva.

Etiquetas

204. Cuestión de perspectiva.

El otro día me desperté a eso de las tres de la madrugada con el estómago algo revuelto, así que me levanté de la cama y fui a la cocina a prepararme una manzanilla: puse el agua a calentar, coloqué la bolsita de manzanilla y cuando el agua empezó a hervir la eché en la taza y lo acompañé con una cucharita de azúcar y una rodaja fina de limón. Como hacía mucho calor dentro de casa decidí salir al jardín y tomarme la manzanilla sentado en una silla de la terraza. Era una preciosa noche de verano y las estrellas brillaban iluminando el cielo con millones de diminutos puntos de luz –esa fue una de las razones por la que me vine a vivir a este pequeño chalet situado a las afueras de un precioso pueblo de montaña: poder disfrutar de las estrellas; algo casi impensable en la ciudad–. El caso es que tomé un par de sorbos de la taza, la coloqué en la mesita que estaba junto a la silla y cerré los ojos intentando conciliar el sueño. Sin embargo, en ese momento, un potente foco de luz me sobresaltó: un foco de luz, que procedía vertical del cielo, me enfocaba directamente e iluminaba el jardín. Me hice sombra con las manos e intenté mirar hacia arriba, pero no conseguí identificar el origen de esa extraña luz. Pensé que podía proceder de un helicóptero pero lo descarté porque no oía el ruido de las aspas. Realmente estaba intrigado y algo asustado. Pocos segundos después descubrí el origen de esa potente luz y fue cuando realmente de sobresalté: vi descender lentamente y en el más absoluto silencio una especie de vehículo espacial de forma semicircular, del tamaño de un camión grande, aunque más ancho y aerodinámico, con una cubierta de algo similar al cristal translúcido en la parte delantera. Cuando la nave estuvo casi al nivel del suelo el potente haz de luz disminuyó de intensidad y una ventanilla se abrió en el cristal de la nave. Lo que sucedió a continuación me dejó paralizado.
―Perdone que le moleste a estas horas, ¿podría indicarme cómo se llama la estrella alrededor de la que gira este planeta?… es que se me ha estropeado el navegador, ¿sabe?, y necesito orientarme…; es la primera vez que vengo a este lejano rincón de la galaxia –me dijo la piloto de la nave: una extraña mujer –bueno, creo que era una mujer–, de grandes globos oculares completamente azules, con las pupilas similar a las de una serpiente, y piel moteada azul-anaranjada, con el cabello largo trenzado de color azul oscuro y cuatro brazos largos y musculados.
Os aseguro que eran cuatro, porque, cuando hablaba, no paraba de mover tres de ellos mientras con el otro sujetaba lo que supuse que sería el volante de la nave; no os puedo describir cómo era de cintura para abajo porque no llegué a verla de cuerpo entero, aunque casi mejor así, creo yo.
Sin salir de mi asombro le contesté: «el… sol…», y mi voz sonó como la de un autómata oxidado.
―¡Vaya!, pensé que sería Alpha Centauri, ¡pues sí que me he desviado de mi ruta!… ¡Gracias! –me contestó con una sonrisa–. Por cierto… ¿no tendrá por casualidad una matriz de hadrones portátil, verdad?… No claro… –se contestó ella misma–, no la han inventado todavía… Bueno, muchas gracias de nuevo por la información y disculpe las molestias.
Yo seguía paralizado de la impresión, así que no fui capaz ni de responderla. El caso es que se cerró la ventanilla y la nave emprendió el ascenso igual que había descendido: en total y absoluto silencio, aunque esta vez sin el potente foco de luz. Entonces aceleró como un rayo y se perdió entre las estrellas. Yo tardé toda la noche en volver en sí; me tomé cinco tilas y dos copas de whisky. Realmente fue una experiencia increíble que, debo reconocer, me ha permitido replantearme muchas cosas y contemplar la vida, y hacerla frente, de forma más enriquecedora, con más… digamos… perspectiva, dando importancia a lo realmente importante: a la vida en sí y no a las cosas intrascendentes que nos hemos autoimpuesto los humanos.
No se lo he contado a nadie, evidentemente, porque nadie me creería; además no tengo ninguna prueba que lo demuestre: ni siquiera llegó a posarse la nave en mi jardín, así que sólo tengo mi palabra. Eso sí, desde entonces, cuando sale el tema en conversaciones con amigos y conocidos, apoyo firmemente la existencia de vida inteligente en otros planetas, y cuando me preguntan por qué estoy tan seguro de ello les suelo decir que en el tema de la vida alienígena tengo una ineludible convicción personal…
―Se trata, simplemente, de una cuestión de perspectiva –les respondo, y pienso en aquella noche de verano en la que vi una nave espacial y una extraterrestre habló conmigo.

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

Cuentos sin importancia 204-Cuestión de perspectiva-PORTADA

________________________________________

203. Los tres ladrones.

Etiquetas

203. Los tres ladrones.

Normalmente el zorro se comería al ratón y éste a la mariposa que revolotea junto a las flores que adornan la ventana de la casa de campo de un matrimonio joven recién mudado de la bulliciosa ciudad; sin embargo érase una vez un zorro, un ratón y una mariposa que mantenían una insospechada relación de amistad y cooperación entre ellos porque, mientras la mariposa revolotea alrededor de las flores que adornan la ventana y llama la atención de la joven mujer y la distrae, el ratón entra raudo por debajo de la puerta de la cocina que da al jardín trasero y pasa veloz por delante del joven marido que en ese momento está terminando de preparar una deliciosa tarta de frambuesas y cerezas frescas, y el hombre deja la tarta sobre la mesa de la cocina y corre con una escoba tras el ratón con intención de echarle de la casa, y es entonces cuando el zorro arrampla con la tarta sin que se entere el joven matrimonio y el ratón se escabulle y sale al jardín sin ni siquiera recibir el más leve impacto de la escoba y la mariposa vuela veloz tras el ratón; y es cuando el matrimonio regresa a la cocina y observa que la tarta ha desaparecido mientras, a unos cientos de metros, entre los árboles del cercano bosque, un zorro, un ratón y una mariposa comparten la sabrosa tarta de frambuesas y cerezas frescas. Y es que a veces es conveniente hacer amigos insospechados para obtener beneficios que de otra manera serían inalcanzables.

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

Cuentos sin importancia 203-Los tres ladrones

________________________________________

• Haiku 420 – 424

Etiquetas

• Haiku 420 – 424

[420]

Este verano
busco paz y orden en mí;
cajón de sastre.

Este verano busco paz y orden en mí; cajón de sastre.

[421]

La mies es mucha
los obreros son pocos;
a pleno sol.

La mies es mucha los obreros son pocos; a pleno sol.

[422]

Llegan las olas
a orillas del mar azul;
los niños juegan.

Llegan las olas a orillas del mar azul; los niños juegan.

[423]

En noches negras
las farolas atraen;
lobos hambrientos.

En noches negras las farolas atraen; lobos hambrientos.

[424]

Del sol ardiente
se ocultan los cangrejos;
bajo la arena.

Del sol ardiente se ocultan los cangrejos; bajo la arena.

 

Luis J. Goróstegui
#haiku

________________________________________

202. Ojos claros.

Etiquetas

202. Ojos claros.

Paseando por el parque, me encontré con ella. Esos grandes ojos claros me atravesaron el alma desde el primer momento en que nos cruzamos las miradas y en ese preciso instante lo supe todo: que vino con su familia en una gran nave espacial; que se perdió una noche de luna llena y su familia tuvo que huir para salvar sus vidas, porque los humanos les perseguían; pero que sabe que volverán a buscarla y, mientras tanto, busca a alguien que la cuide, y que ese alguien soy yo. Desde entonces la cuido como si fuera mi hija y vivimos juntos esperando el momento de su regreso al hogar y no puedo ni sé cómo expresar todo lo que en este tiempo me ha enseñado: a ver el agua como algo vivo y deslumbrante; a respirar el aire como si rezara una oración; a caminar sobre la hierba húmeda como si paseara sobre lo más precioso del universo; a sentir los rayos del sol como el mayor regalo de la vida; a apreciar una sonrisa como si me fuera la vida en ello, porque es origen de felicidad y fuerza; a comprender el sufrimiento del prójimo incluso mejor que si fuera el mío propio; a sentir la imperiosa necesidad de ayudar al necesitado porque de ello depende la vida y la alegría del universo, aún del más lejano alienígena que viva en el más lejano planeta del cosmos. Porque sentía lo que ella sentía, y comprendía lo que ella comprendía y de la extraña forma con que ella comprendía la vida.
De eso hacía ya casi una vida, aunque ella apenas había envejecido. Una noche sin luna alguien llamó a mi puerta, abrí y un hombre y una mujer altos, de cabellos negros y de grandes ojos claros, me dijeron que venían a por su hija. Me dieron las gracias por cuidar de ella, y sin decir palabra alguna miraron a la niña con esa mirada suya tan profunda, como si hablaran con la mente… o con los ojos. Justo antes de irse, la pequeña me dijo:
―Recuerda que la vida es preciosa, apréciala, cuídala. Gracias y adiós. Y vive.
Y ante mis ojos se desvanecieron en el aire. Desde entonces vivo; antes sólo existía.

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

Cuentos sin importancia 202-Ojos claros-PORTADA

________________________________________

Entre fractales, año I

Etiquetas

mariposas-rafael_araujo_proporcion_aurea_2

Entre fractales, año I.

[Un #cuento de microcuentos, de Luis J. Goróstegui]

 

Érase una vez…, todo comienza con un érase alguna vez, y, a través de cada palabra, logramos alcanzar el todo; perspectiva, visión de conjunto, eso prevalece. Lo que escribes no tiene sentido, me dices; ¡oh, no, sí que lo tiene!, te respondo. Quizá si me lo explicas mejor; que lo descifren otros o si no que mi secreto se venga conmigo. Así, todo junto. Existen dos formas de escribir un galimatías, una como el demente que lanza al vuelo las palabras y observa complacido el desorden provocado; otra, como el neurocirujano que con precisión matemática sitúa cada palabra en su posición inequívoca. Así es y, sin embargo, el loco y el cuerdo comparten habitación. Permitidme que os guíe por el érase una vez más…
En los sótanos de la consigna de la estación han encontrado un maletín aparentemente olvidado; antiguo, pero en cierta forma demasiado contemporáneo, incluso anticipado a su tiempo, o quizá no, es complejo precisarlo a pesar de las apariencias, de las pistas; en su interior hay un libro manuscrito, un extraño diario. Todo está intrincado, como reflejo directo de los pensamientos de su autor; su lectura ofrece una extraña sensación, como si se concatenaran diversos puntos de vista, aunque no distintos autores, como si contempláramos su mundo a través un caleidoscopio hecho a su medida, como si transitáramos entre fractales poliformos. Un experimento, una yuxtaposición de sensaciones. Tú dirás.

Mes 1.

Todo el mundo quiere cambiar, ser otra persona; ya sabéis: «Año nuevo, vida nueva», dicen. Pues yo me siento bien siendo como soy; acaso sólo me pasa a mí. Las nubes ocultaban ballenas. Las nubes le abrieron paso a aquella nave interestelar procedente de no se sabe dónde, con destino a no se sabe dónde. Sólo permaneció unos minutos en la Tierra, abasteciéndose de agua. Luego retomó el vuelo y desapareció tras las nubes de aquel martes. Las nubes formaron figuras etéreas entre montes infinitos y la lluvia indefinida. Dime viento, ¿dónde vas?; dime viento, ¿qué me cantas? Las nubes de aquel martes sabían a azúcar y miel. Cuando llueve se perfilan, el resto del tiempo están como difuminados. Entonces es cuando los alienígenas que viven entre nosotros salen a pasear; tiene que ver con algo de la energía gammagráfica de la que están conformados. No sospecho de mi poder: ¡Escucha, infeliz! –me digo–, la tierra fue mi refugio, el mar mi salvación; no temo, pues no moriré para siempre. Recordadme lo que digo aquí, para que cuando tenga lugar, no me sorprenda la oscuridad y sepa cómo actuar y venza.
Ayer establecí contacto con una especie alienígena, y el gobierno me ha exigido que lo mantenga en secreto. Me he negado, claro, y me han encerrado en lo más profundo de un volcán, en una isla del pacífico. ¡Socorro, rescátenme! P.D. No sé dónde está la isla. He visto que la gente no cuida su planeta. Dicen hacerlo, pero no lo hacen. No lo comprendo. ¡Acaso piensan que es fácil encontrar otro donde vivir que sea tan bueno como éste! ¡Sí hubieran vivido en mi planeta de origen sabrían lo afortunados que son! La gente paga millonadas por un trozo de piedra tallada de un museo y, sin embargo, destruye montes y bosques y contamina los mares. Desde luego estos humanos no hay quien los entienda. Los extraterrestres ya han venido, ya nos han visto y ya han salido corriendo, horrorizados al comprobar lo salvajes que aún somos. De noche, desde las ciudades, no se ven las estrellas. Las personas alzan la mirada y sólo ven el cielo negro. Por eso están tristes, porque no ven las estrellas. No se dan cuenta de lo maravilloso que es el universo. Yo, que he viajado por el espacio, lo sé.
Indómito. Me consideraban «el extraño» y no me importaba saber que me llamaban Juan Nadie. Indómito, quise probar a dar la vuelta al mundo y comencé desde la estación Términi de Roma, simplemente porque me apetecía; quise tocar la fama y alguien me dijo «¡toma el dinero y corre!» y así lo hice. Juro por el honor de los Prizzi que ni el cielo protector ni los reservoir dogs ni mucho menos el infierno del monster’s ball me impedirán sentir la lluvia en mi cara. Al fin y al cabo yo sólo soy el pianista, no una mercancía predestinada al sexo. En la cocina se estropeó el gas. ¿Con qué cocinaré ahora?, se preguntó la cocinera. Menos mal que vivía en un reino de cuento de hadas. Siempre le quedaba utilizar su mascota: el dragón escupefuego que capturó en la última cacería. En la cocina, la bruja de la casa de chocolate acabó asada en su salsa, no debió subestimar a esos dos hermanos –Hansel y Gretel dijeron llamarse– que le pidieron ayuda para pasar la noche. En la cocina de Hades, el can Cerbero jugaba con los despojos. ¡Déjalos ya, Cerbe! –le recriminó Hades–, te tengo dicho que no juegues con los muertos, que ya no están para estos trotes.
No es que no me guste salir en las fotos, no, no es eso; tampoco es que tenga miedo a que me roben el alma, que va, simplemente es que no quiero que averigüen que no salgo en ellas. Es lo que tiene ser un vampiro. Poderosa llave la que abra la puerta del oculto destino. Fue sólo la humilde sencillez la que supo oponerse a la infernal criatura. Para liberar las aguas remotas de las islas de los monstruos sin alma, sólo los hechizos de la bruja lo conseguirán. Cuentan que Lincoln fue un buen presidente –no lo dudo–, pero nadie sabe que también cazaba bestias marinas: las atraía con el cebo de una joven muchacha y, cuando atacaba el monstruo, le degollaba con su hacha. Así mató cientos. ¡Oh, dioses del recóndito océano!, bendecid las aguas y que nuestras pescas sean abundantes todo el año. Aceptad, oh dioses, este humilde sacrificio que os ofrecemos y, confiando en vuestra magnanimidad, os rogamos que nos protejáis como en años anteriores. ¿Por dónde vagan las partículas energéticas –o iones rápidos– que se producen en un reactor tokamak de fusión nuclear, como el del experimento ITER que es construye en Francia? Quizá conformen mundos más allá del horizonte.
A su debido tiempo. A su debido tiempo todo sucede, sin remedio; a su debido tiempo nada queda, sin remisión; a su debido tiempo nada falta, nada sobra; a su debido tiempo nadie muere, pues todos viven. A su debido tiempo.
―¿De dónde vienes? –le pregunté.
―Traigo grifos –me dijo el cazador.
―¿Grifos?, pensaba que ya no había.
―Sí, ya no queda ninguno en el valle. Me he tenido que ir más allá de los Montes Helados. Espero que alguno me valga.
―¿Y eso?
―Tengo estropeado el de la cocina.
Retumbando entre peñascos rueda sin freno la descomunal roca que, ciega de rumbo, rompe y destroza todo lo que osa interponerse en su loco devenir. Fue el titán Atlas quien la dejó marchar cansado de tener que cargar con ella a todas horas. Zeus está que trina. Cuando pasees por el bosque fíjate en los árboles. Es posible que, en lugares frondosos donde antes era imposible acceder, los árboles tengan sus ramas abriendo sendas. Por ahí andan gigantes, tenlo en cuenta. Me senté en un banco del parque, allá donde todo puede pasar, y no te creerás lo que pasó. Cuando llega la noche, los selenitas se asoman a la ventana y miran la Tierra llena, y se preguntan si habrá vida en ese planeta azul. Paseaba por la calle y veía a la gente protegiéndose de la lluvia o corriendo de portal en portal para no mojarse. ¿Por qué huían de la lluvia?, se preguntaba sin comprenderlo. Viniendo de su árido planeta, la Tierra era el paraíso, se decía el extraterrestre. Dicen que los extraterrestres ya han llegado y que viven camuflados en la Tierra. No sé de dónde han sacado eso, nosotros no se lo hemos dicho a nadie; sería de tontos que los humanos nos descubrieran, precisamente ahora que estamos a punto de iniciar la invasión. Una vez naufragué en una isla donde sus habitantes vivían sólo un día: nacían al amanecer y morían cuando amanecía el día siguiente. Cuando les dije que yo vivía años enteros me tomaron por un inmortal. Desde entonces veo el tiempo de otro modo, como un dios. En el fondo, hijo, el tiempo es un «déjà vu» olvidado. Escúchame, hija: el tiempo, por sí solo, no existe; sólo es un colateral de la vida.
―¿En la antigüedad, la gente creía que existieron los titanes?
―Sí, pero eran otros tiempos.
―No, papá, el tiempo es siempre el mismo; somos nosotros los que cambiamos.
Aquel día la cámara de captación de neutrinos antártico –el IceCube, la llaman– logró identificar aquel tipo de neutrino –«estéril», le denominan los científicos– tan anhelado. Era una llamada procedente del espacio profundo: los alienígenas pedían cita. Aquel día la cámara mortuoria de la gran pirámide permanecía cerrada. No se permitía el paso a nadie hasta clarificar lo sucedido. No era posible lo que decían algunos trabajadores, la momia no podía haberse levantado. Sin embargo ya no estaba en su sarcófago; y la cámara de proyección estropeada de aquel cine abandonado comenzó a proyectar una película muda, a los fantasmas también les gustan las películas, sobre todo las antiguas, les gusta recordar sus años de juventud; y la cámara de muy alta presión hidrostática del laboratorio submarino que la agencia gubernamental ultrasecreta tiene en algún lugar del Pacífico recibió un inquilino asombroso, por fin habían capturado vivo un ejemplar de homínido submarino.
Hablemos de humo. Por el humo se sabe dónde está el dragón escupefuego. En tormentas de fuego, el humo te indicará el camino. Construí un barco con humo de una fogata y navegué. La magia del mago procedía del humo de su pipa. El mago se fugó de la cárcel convertido en humo. Mary Poppins se maquilla con el humo de las chimeneas. Ella es fuego. Él, el humo que queda tras consumirse. Sherlock Holmes era un experto catador de humo de pipa. ¿Qué dice? No sé, no sé hablar señales de humo. No dejes que el humo te impida ver el bosque. ¡Mil rayos y mil truenos y un volcán echando humo! ¿Tabaco o pipa? Pipa, su humo es mucho más inspirador. Desde que prohibieron fumar, en el estanco sólo venden humo. ¿Qué falló de la poción? ¿Pusiste humo de escarabajo asado? Mi señor don Quijote, ¿qué es aquello? Humo; ¡habrá dragones!
A aquel vampiro le gustaba volar entre las nubes y contemplar el amanecer. Permanecía allí arriba hasta el último segundo, hasta que los rayos del sol casi le rozaban su blanca piel. Le gustaba vivir peligrosamente. ¿Cuál es más bello: el lenguaje hablado o el escrito? No, es el pensado, el sentido, el lenguaje amado. Mamá, ¿quiénes eran los humanos? Nuestros antepasados, hijo –le respondió su madre–. ¿Por qué ya no hay ninguno? Hubo una guerra entre ellos y los robots. ¿Y qué pasó? Que ganamos nosotros. Plagiador que plagias, ignorante que te crees ingenioso, ¿acaso ignoras que se atrapa antes a un mentiroso que a un cojo?; secuestrador de ideas ajenas, vil tramposo, tejedor de falacias, idiota. ¡Si no tienes ideas propias, no escribas! Permíteme un consejo: más vale ser autor de los propios escritos, aunque éstos sean pobres y humildes, que intentar engañar a la gente copiando el ingenio de otros. En aquel rincón del parque, donde las hojas de los árboles colindantes dejan rastros de migas de pan, hay un banco sin igual, donde quien en él se sienta viaja inminente a lugares imposibles; pues alguien dejó en él un libro. Perseguía al dragón. Me introdujo en un callejón sin salida. En eso llegó la policía.
―¿Dónde está? –me preguntó un agente.
―Se ha ido por ahí –le dije, señalando al frente.
―Pero eso es un muro de ladrillos.
―Sí, ahora sí.
El bosque está repleto de criaturas extraordinarias. Caminamos entre los árboles, entre los arbustos y no las vemos. Insectos, pájaros, con suerte alguna ardilla voladora, sí, a esos sí; pero a las hadas, duendes, seres hoja y demás criaturas mágicas, no, a eso no. Los hongos se iluminan de noche. Hay insectos que se iluminan para ver en la oscuridad. Algunos peces abisales brillan en lo más profundo del océano. Hace eones que los animales usan la electricidad. Y nosotros buscando seres mágicos de cuentos de hadas. Dicen que los faros iluminan el mar para que los barcos no choquen contra las rocas; dicen que los fareros son casi como ermitaños; dicen, dicen… Lo cierto es que los faros nos protegen de los seres malignos del mar y los fareros son los mejores guerreros del mundo. Alza el vuelo una bandada de aves, todas a la vez, y el cielo se oculta tras la nube uniforme de las trazas de sus alerones y no lo veo, y, aprovechando el tumulto, entre la mareta de alas y picos, un diminuto gorrión se abre camino y rompe la nube como cohete audaz. Noble tarea la de aquel enigmático marinero inglés que supo descifrar el porqué del existir de las estrellas de mar; pues, al igual que las botellas donde los náufragos envían sus mensajes, las estrellas del mar, como luminosas estrellas del firmamento, contienen nuestros más profundos sueños y anhelos. Feliz aquel que libera esos sueños del olvido y les permite volver a ser libres para que puedan cumplir su sagrada misión. Anochecía. En un oscuro callejón un gato observaba. Aguardaba paciente. En eso vio venir a un joven. Cuando llegó a su altura, atacó. Después el vampiro recuperó su aspecto felino y desapareció en la oscuridad. Estuvo bien la espera, se dijo satisfecho; hacía tiempo que no cataba sangre del ‘85. Tras la caída de aquel extraño meteorito, los bosques se cubrieron de una gelatinosa niebla y, tras diluirse, los animales son ahora gigantes; incluso las hormigas han crecido al tamaño de elefantes. Los humanos somos ahora las hormigas de la Tierra.
Infancia. Amanece un nuevo día. Esta noche ha nevado y en el suelo se ven las huellas de los pasos de la gente, y la joven sale de casa con esa sonrisa que le brota del corazón, camino a la farmacia. Allí compra glicerofosfato de cal, el reconstituyente que necesitan los niños enfermos del orfanato en el que ella vivió cuando fallecieron sus padres. Todos los días les visita y les cuida y les cuenta cuentos y los pequeños ríen y ella recuerda con cierta nostalgia cuando también a ella la cuidaron. Allí pasó su infancia y desde la ventana de su cuarto vio, por primera vez, los colores del arcoíris, y ahora trabaja allí como voluntaria para, de alguna manera, poder devolver todo el cariño que recibió entonces.

Mes 2.

Quise mirar al cielo, pero el cerezo en flor me lo impidió; un enjambre de abejas revoloteando. Entre los árboles vi hadas; primavera en lo profundo del bosque. En lo más alto de un monte, perdido entre una cordillera inaccesible, me encontré una manada de elefantes que se colgaban de los árboles como monos con trompa; ¡aún nos queda tanto por descubrir!… En el mar adentro en calma y con el cielo claro una ola surge solitaria; bajo ella un gigante de las profundidades juega al escondite. Se celebra un partido de tenis estelar. Los jugadores salen a la pista. Primera pelota… Saca el cinturón de asteroides… El meteorito pasa rozando la Tierra… Primer punto para la constelación de Orión… El partido se prevé eterno. Mira, la luna. Hubo un tiempo en que en ella vivía gente. ¿Cómo lo sabes? Mírame bien, ¿acaso te crees que mis antenas son humanas? Recuerdo cuando llegaba la noche y me asomaba a la ventana y miraba al cielo y me preguntaba si habría vida en aquel lejano planeta. Un día construí una nave y me marché allí. Desconcertado, paseaba por sus calles y veía a esos seres protegiéndose de la lluvia o corriendo de sitio en sitio para no mojarse. «Sorprendente, ¿por qué huyen de la lluvia? Viniendo de un planeta tan árido como el mío, ¡la Tierra es el paraíso! Los humanos están locos, no saben lo que tienen», se extrañaba el marciano sin comprender.
¿Por qué escribes? ¿Has leído Hansel y Gretel? Sí. ¿Por qué iban dejando un rastro de migas de pan? Para no perderse en el bosque y saber el camino de vuelta a casa. Pues por eso mismo escribo yo. ¿Y la luna? Se la tragó un dragón. ¿Un dragón? Sí, le perseguía el sol. ¿El sol? Sí, es que buscaba a la luna. ¿A la luna? Sí, porque le perseguía un dragón. En aquel pueblo, «el endauph» deambula por las noches y devora autoestimas como un güirfunzo cualquiera.
―¡No me miréis!, ¿sois abejas?, ¡por favor, no me absorbáis el alma!
―¿Qué clase de escarabajo pelotero haría una pregunta así?
―La araña se me comerá, ¡ayudadme!
―Acaso ignoras que la clave está en el hormiguero.
―Lo sé, pero el gorrión no me dejará llegar a él.
Nunca hay que aterrizar encima de un monstruo, es de sentido común. Me quito el sombrero ante ti, me has enseñado mucho. Es el sonido de las abejas, ¡bienvenido! Come y bebe, porque mañana vamos a tragarnos a esos indeseables. ¡Cómo sabemos que no eres un espía! Es curioso, miro al cielo y veo tres soles y esa luna rodeada por sus anillos tan cerca de mí que alzo la mano y creo poder tocarla con la mano. Eso hace que sea como soy. Andando por el campo las espigas me llegan al ombligo y acaricio la fina línea del horizonte que me separa del cielo y miro a lo lejos y veo la nave espacial que busca un lugar donde aterrizar y sé que me busca a mí y sigo caminando y sé que me ha detectado y corro. En la pequeña tienda de antigüedades el dueño me mira y sonríe y alarga sus ocho largos brazos y alcanza el objeto que le he pedido. «¿Por qué quieres un corazón nuevo, acaso ignoras que está prohibido amar?», me pregunta mientras lanza su lengua y caza un ratón. Los niños patinando sobre el lago helado y de una grieta en el hielo surge un tentáculo que acecha y agarra a uno y lo hunde por el agujero. Los otros miran en silencio y continúan jugando, pues sólo los supervivientes merecen llegar a ser adultos. Está escrito. Alzó las manos apuntando a la cima del monte más alto y las cerró con fuerza y el pico del monte saltó por los aires en mil pedazos y allí surgió la araña gigante de la que hablan las viejas leyendas. Había pasado con nota la primera de las pruebas para ser brujo. Cada vez que la joven se ponía sus zapatillas de ballet danzaba como vuela alegre un pajarillo tras pasar meses sin salir de su jaula. El fantasma de su anterior dueña aguardaba con entusiasmo esos momentos de infinita libertad. Amanecía en el mar. El sol, cansado de hacer todos los días lo mismo, decidió darse un chapuzón en el agua. No me mires con esos ojos de gusano de seda metamorfoseado en buey de las nieves, no quisiera tener que seguir tus huellas de seis dedos y escuchar tus relinchos de salmón escupefuego. Hazme caso y vuela raudo a otras tierras antes de que despierte de mi letargo. ¿No sabes que los monstruos que llevas en tus bolsillos provienen de la indignación de cuando estabas muerto? La imaginación hace milagros.
Insospechada capacidad. Siempre me ha sorprendido comprobar cómo la tela de seda de una minúscula araña puede tener la fuerza, quizá incluso la insospechada capacidad, de detener el proyectil en que se convierte un mosquito cuando vuela a toda velocidad; quizá sea también por eso que no me extrañe percibir mi alma rebosante de felicidad al poder seguir el rastro que tu rostro deja en el aire que respiro. Seda indómita:

Rebelde cual seda indómita,
fuerza en que el alma habita en tu rostro,
aunque apto para seguir las huellas más allá del abismo de tu mirada;
aire que respiro, sustento de mi inquietud final,
trova al amanecer del sol que ilumina mis manos,
pues el racimo de glosas al término de mi camino
sea quizá mi recompensa merecida.

Todas las noches me llamaba, siempre a la misma hora, y me decía que me quería, que no podía vivir sin mí. Yo escuchaba su voz trémula y callaba. Mis manos temblaban. Hacía años que ese teléfono analógico ya no funcionaba, ni siquiera estaba enchufado. Buscaban una fuente limpia e infinita de energía y pensaron que abriendo una fractura en el continuo espacio-tiempo podrían conseguirlo. Dos días después de conseguirlo, los monstruos de la otra dimensión se comieron la Tierra. Fabricaba las mejores cajas de música de la ciudad. Abrir una era como asistir a un concierto en directo; la música sonaba de cuento de hadas. Al final se hizo justicia y el artesano fue condenado por explotar laboralmente a las hadas encerradas en sus cajas. Sólo sé que lo que sé no me sirve de nada. Veo mundos en una hoja de papel, palabras al asomarme a una ventana. Cuando el mar se tornaba en calma sin causa aparente, los habitantes de aquel pueblo costero se escondía en los bunkers subterráneos; los monstruos estaban llegando. Tras la niebla, el silencio; luego, el horror. ¿Sólo me lo parece a mí?… Si nos invadieran los extraterrestres más sanguinarios del universo, los titulares de algunos telediarios no podrían ser más alarmantes que cuando anuncian nuevas nevadas y bajadas de las temperaturas.
―Hoy me toca limpieza de mi biblioteca.
―¿Se te llena de polvo?
―Oh, no, es que me toca reordenar los personajes de mis libros.
―Querrás decir que les quitas el polvo a los libros.
―No, reordeno los personajes. No sabes cómo les gusta intercambiarse de libro.
―¿Qué has escrito?
―Poesía.
―Pero está escrito en prosa y su protagonista es un robot.
―Pues eso, poesía.
Cuando lees sobre el pasado, conviertes el pasado en ahora; cuando lees sobre el futuro, conviertes el futuro en ahora; ergo la literatura es una máquina del tiempo; todo es ahora. Esta tarde he dibujado una panadería recién abierta, era de madrugada en el papel, y el olor a pan recién hecho inundaba la habitación donde dibujaba. No pude contenerme y cedí a la tentación. No creo que esta noche cene nada. La calzada está empedrada, como las de antes. Acaba de llover y, en un rincón, el agua ha formado un charco. Al asomarme a él veo un coche aerodeslizador que levita, como los que habrá en el futuro. El charco es una puerta al futuro. Sssssh, no se lo digas a nadie. Es una radio muy antigua, de esas de válvulas y eso, y ya no sintoniza ninguna emisora, pero me niego a tirarla, con ella hablo todos los días con mi madre; murió hace un año. Sobre la cima del monte más alto de la cordillera apareció de súbito un arcoíris inesperado, pues el clima era seco esa mañana; nadie se percató de la nave espacial que, tras las nubes, se posó en la cumbre. Esa tarde bajaron al pueblo unos forasteros de ojos negros. Entre retazos de niebla deambulo ecuánime tras la risa del ogro bueno, aguardando la presencia reconfortante del eco esponjoso que reviva la fuente de agua viva, allí donde el gigante canta hondo. Veo huellas de gigante y árboles tronchados que indican un camino a seguir y me lleva del bosque a la orilla del mar y me detengo en la orilla y las olas me cubren y las huellas se sumergen y nado y me sumerjo y buceo y las huellas siguen y el gigante me aguarda. Cuando desperté, el dinosaurio todavía estaba allí y cuentan que el cierzo despeinaba los árboles y se escuchaba a la quebrada cantar dolorosas, y se cuenta también que los dragones todavía estaban allí –los últimos– lamiéndose las heridas al abrigo de sus refugios inciertos. Me despierto y no sé dónde estoy y me levanto de la cama y siento el suelo frío y encuentro la puerta a tientas y me da miedo encender la luz por si me ven y abro la puerta lentamente y hay otra habitación y veo a alguien que, desnudo, abre otra puerta y mira fuera. Yo no soy yo, yo soy tú, ¿no te das cuenta? A veces me siento como ese niño de dos años que intenta ponerse de pie y se cae y lo vuelve a intentar y se cae y trata de andar y se vuelve a caer y en eso que cuando ve un polluelo de patito que corre por la casa se levanta… y corro tras él y no me caigo. El tiempo no es eterno; el eterno soy yo. En la noche oscura, las sirenas aún salen del mar y bailan en la playa cuando no son vistas. Es una tradición de antaño, cuando los humanos aún eran amigos y bailaban junto a ellas. En una ocasión luché a muerte contra un ogro. Me lo topé paseando por un lejano bosque. El muy presuntuoso me subestimó y me permitió decidir el arma con la que luchar. Le maté de risa contando chistes.
―¿Sabes bailar?
―Sé cocinar.
―¿Y…?
―Dicen que trabajar en una cocina es un baile en sí mismo.
La niña mira al mar, en silencio, y, cuando la playa queda vacía de gente, deja trozos de pan y algo de fruta al borde del agua. Luego se va, sonriendo. Cuando cae la noche y sólo la luna ilumina la playa, el monstruo sale del agua y se acerca a la comida. Mar adentro, en las noches sin luna, cuando las olas surgen cual gigantes de agua, las ballenas bailan sobre la línea del horizonte como gráciles criaturas que revelaran ancestrales poderíos aún no olvidados. Me pasé todo el día recogiendo setas en el bosque. Al anochecer, de regreso a casa, me topé con un grupo de duendes. No tuve más remedio que devolverle las setas: me querían denunciar por desahucio ilegal. Sólo escribí un punto y coma, sólo uno; la gente, atónita, me consideró un revolucionario. En noches sin luna y con el cielo negro profundo, caminaba paulatino, y según avanzaba, las farolas que dejaba atrás oscuras quedaban; sólo las que tenía por delante iluminaban la senda. Le resulta agradable recorrer otros lugares, visitar otras ciudades, bañarse en otras aguas. En esta ocasión ha elegido los canales de Venecia. Acostumbrado a los fríos de las Tierras Altas de Escocia, las aguas cálidas de Italia son un spa para el monstruo del lago. Sólo cuando los ríos suben torrenciales, la luna baja del cielo, serena; cuando la brisa despeina las hojas, sin percatarnos, cantan los grillos; cuando entre risas y cantos el eco retumba serenatas olvidadas, las estrellas danzan al infinito. Sólo entonces. Nacimos en tiempos equivocados con el único objetivo de convertirlos en propicios; ojalá lo consigamos, ojalá, por el bien de la humanidad.
―Cuentan que en un bosque perdido nació un ciervo ciego.
―¿Y cómo sobrevivió si no podía ver?
―Se hizo amigo del oso; él le protegió.
En las noches de invierno el ratoncillo duerme dentro de una hogaza de pan; al amanecer no necesita salir para buscar comida. Una flor de tiesto se pregunta cómo será vivir en el campo, sin los humos de los humanos; pero no encuentra respuesta. Quizá si pudiera andar… Entre un montón de ropa sucia, el gato acecha silencioso, agazapado; se siente dragón. Pobre aquel ratoncillo que, distraído, rebusca entre las flores del jardín. En su castillo al conde Drácula visité. Por accidente me corté la mano y mi sangre brotó; y el conde, que la vio, con ansiedad se me acercó y se ofreció a curar la herida; y en un descuido mío me mordió la mano; por eso desde entonces vampiro soy. ¿Habéis visto uno de esos ascensores de hierro del siglo XIX; a que parecen una máquina del tiempo?, pues lo son; he construido una y el ascensor tiene la estructura perfecta para encajar en el flujo espacio-temporal que se forma al ejecutar la secuencia de arranque. Llegué en bicicleta al borde del abismo, al fin del mundo, y allí aguardé a que llegara; una ballena azul, entre las nubes, me saludó. Primero guardamos los animales en zoos y parques, «para evitar su extinción», decíamos optimistas, pero no lo conseguimos; luego pasó lo mismo con los propios árboles del bosque; ahora aguardamos nuestro final, resignados. Existe un planeta, allá en el espacio profundo, donde los dragones nacen de la fruta: los dragones blancos, del coco; los naranjafuego, de las naranjas; los verdes escupefuego, de las limas. Las guerras entre ellos son una macedonia descomunal. En casa no tengo gatos ni perros, ni siquiera un periquito o una tortuga, que va, sólo tengo un par de precioso dragones de la fruta; no me diréis que no son un encanto, ¿verdad?

Mes 3.

A través del ventanal sucio de la vieja casona abandonada una joven mira en silencio, recordando, añorando; hace ya diez años, sin embargo, que nadie vive en la casa, pues nadie se atreve desde aquel incendio en el que murió una joven. Cada letra es un mundo, cada palabra un sistema solar; una frase, una constelación; un párrafo, una galaxia; un libro, un universo. En la entrevista me preguntaron qué libro le regalaría a un bombero, le contesté «Fahrenheit 451»; ¿y a un pastor?, «¿Sueñan los androides con ovejas eléctricas?». ¿Y eso?, «por asociación de ideas opuestas». No me dieron el trabajo. Era un escritor fuera de serie, como si hubiese nacido antes de su tiempo. Era tan innovador que en sus libros utilizaba palabras que aún no existían. Lo extraordinario es que doscientos años después de su muerte sus palabras han cobrado pleno significado. Hace tanto que no salgo por la noche que casi se me ha olvidado cómo ocultarme en las sombras y atacar a la yugular; volar no se olvida, es como montar en bici. La próxima vez paso de hibernar. Le encanta el cine, se pasaría el día entero viendo películas; se las sabe de memoria todas. Hoy ha amanecido nevando y sale a la calle y baila bajo las farolas aún encendidas como si fuera Gene Kelly; el pequeño robot disfruta como un humano. En lo alto, el observador contempla con perspectiva clarificadora; abajo, la gente no ve por encima de sus paraguas, y así les va. Aguarda a la sombra, paciente, y cuando llega aquella pareja se lanza veloz y desgarra sus cuellos, deseoso, insaciable; al vampiro le gusta demasiado la sangre. Desde luego no tiene intención de hacerse vegetariano, ya encontrará otro método para adelgazar. Alicia le dijo a Cenicienta que Blancanieves vio cómo Maléfica hechizaba a Belladurmiente con un conjuro mortal. Maléfica huyó y todos iniciaron las pesquisas para averiguar cómo poder revivir a la joven princesa. El resto es un cuento. Caperu llevó a su abuelita la cesta de galletas. Al regresar vio como una nave alienígena aterrizaba en el bosque y vio salir de ella a su piloto, pero no se amilanó, estaba preparada; si pudo con el lobo, podría con el predator. La gente pasaba a su lado y ni siquiera la miraban, como si no existiera. La joven pensaba que no querían hablar con ella, estar con ella, jugar con ella, y no era así; es que nadie la podía ver desde el día en que murió en aquel accidente, pero ella no lo sabía. Escribí un libro de cuentos sobre robots, sus hazañas y sueños, sus aventuras y desventuras; como era un escritor novel lo publiqué con un pseudónimo; no quería que supieran que era un robot. Echaba de menos los viejos tiempos, cuando aún no existían los robots con inteligencia artificial; de vez en cuando iba al mecánico y se reconstruía como un simple electrodoméstico. Era un robot muy sentimental. Aquel día amaneció nevando. Copos grandes, que caían a cámara lenta, como levitando, cubrían todo el suelo; como si alguien estuviera agitando desde el cielo un enorme edredón repleto de plumas blancas. Dicen que los monstruos existen, que son de carne y hueso, y no es cierto. Los monstruos son de tinta y papel, y se meten en la mente y no quieren salir; al menos los de carne y hueso sangran y se pueden matar.
Aquella mañana en la estación, sentadas a mi lado mientras aguardaba el tren, una niña le preguntó a su madre:
―Mamá, ¿qué tren tenemos que coger para ir donde papá?
―Papá está en el cielo, cariño.
―Lo sé, pero en el cielo también hay tren, ¿verdad?
Aquella mañana en la estación subí al tren, me senté junto a la ventana y aguardé paciente. En eso sonó el silbato; un ligero tirón y el tren se elevó, levitó como si fuera un globo de gas, subió lento, en silencio. El techo de la estación se abrió y el tren voló. El suelo tembló. Entonces comprendieron que aquella leyenda, la que hablaba de una tortuga gigante que dormía desde tiempo inmemorial, era cierta; y el suelo se levantó y la montaña alta, la de la cumbre con nieves perennes, comenzó a caminar. Un detalle.
―Dígame, ¿cómo supo que fui yo quien cometió el asesinato?
―Porque era el único que no tenía coartada.
―Pero sí la tenía, estuve en el restaurante comiendo; los camareros así lo declararon.
―Eso quiso hacernos creer, pero la ceniza del cigarro que dejó en el cenicero también declaró, y su argumento sí que fue inapelable.
Subieron donde el eremita y le preguntaron:
―Maestro, ¿cuál es el sentido de la vida?
El anciano les miró.
―La vida no hay que comprenderla para vivirla, pero hay que vivirla para comprenderla –les respondió mientras se preparaba una taza de té.
Era famoso en toda la ciudad, sobre todo por sus jarrones de porcelana, y eso a pesar de que su tienda de cerámicas era pequeña y estaba en un apartado callejón; nadie sabía, sin embargo, que en ellos se retenían el alma de inocentes. Aquel día en el vagón algo cambió de súbito, como si se volviera consciente; lo vi por la ventana, lo sentí en el vaivén, es difícil de explicar: la vía férrea se desvió de su ruta, atravesó el techo y el tren voló buscando libertad. Aquel día en el vagón te besé y el contacto de nuestras bocas provocó nuestra aniquilación y la onda expansiva destruyó la ciudad y su radio de acción alcanzó gran parte del país, todo fue caos y destrucción. Era nuestro destino: tú, materia; yo, antimateria. El extraterrestre aterrizó, ocultó su nave y comenzó a buscar ejemplares de la especie dominante de la Tierra para su estudio. Para ello utilizó, como no podía ser de otro modo, métodos científicos; y no paró hasta encontrar el primer hormiguero. Entre todo el cancionero popular gallego existe una pequeña melodía muy interesante, pues posee acordes asonantes únicos. Cuando aquel extranjero lo escuchó, lloró de nostalgia; le recordaba su hogar, allá en su planeta natal. Y construyeron la montaña rusa más alta y empinada que existía, se subieron a los vagones, tomaron impulso y despegaron rumbo a su nuevo hogar, allá donde las nebulosas aún crean estrellas. Los vivos somos fantasmas para los fantasmas, por eso raramente les vemos; nos tienen miedo. Ese día el puente ocultaba seres mágicos, luciérnagas de fuego y agua, llamaradas de relámpagos; entre silencios y retumbares cantaban las sirenas y los duendes del río bravo, melancólicos; entre risas y quebrantos, esperanzados en un destino favorable. Ese día el puente dio cobijo a un simple barco de papel que acabó varado en la orilla del río. Perdido, el barco tiritaba de frío, ignorante de la suerte que había corrido su pequeño dueño, con el que jugaba desde aquel día en que sus pequeñas manos le dieron vida.

Mes 4.

Las gaviotas alzaron el vuelo,
en formación emigraron;
¿todas?, no;
la última de la fila miró atrás,
se quedó;
tuvo miedo de no llegar y se quedó:
Cuando regresaron no la encontraron.

En lo más alto del peñón, un curioso habitáculo de una extraña aleación, como una nave; y en su centro un ventanal circunvalatorio. En eso el peñón tiembla, se remueven sus cimientos y se eleva, se eleva y se pierde entre las nubes. No exhala gases ni fuego. Y es que el conejo blanco era, sin duda, el señor del tiempo.
―¿Quién ha hecho todo este desaguisado? –gritó la madre al ver el desorden de la habitación de su hijo.
―¡Esa mariposa! –respondió éste señalando a la ventana. [De mayor fue uno de los ideólogos de la Teoría del Caos.]
Andando descalzo sobre la arena de la playa, dejando huellas en el profundo cielo. Era la primera vez que salía de casa solo, así que me armé de valor, aguardé a que un rayo de sol me impulsara y en ese preciso instante me agarré a un pétalo de mi diente de león preferido y salí volando; la visión del jardín desde lo alto me resultó sobrecogedora.
Entre las nubes de abril, entre brisas y arcoíris,
ha logrado escabullirse un intrépido rayo de sol;
los pajarillos revolotean alegres.
Leo libros de ciencia ficción desde la Luna y recorro el universo entre alienígenas, robots, viajes interplanetarios y algún que otro desajuste temporal. Desde allí levanto la vista y saludo a la Tierra cuando necesito situarme en el espacio-tiempo presente. Cuando Alicia regresó al país de las Maravillas, vio que la reina de Corazones se había convertido al taoísmo; lo supo al ver el Yin Yang que habían construido. Todos la apoyaron en la conversión; bueno, todos menos el conejo blanco y un tío suyo que pasaba por allí. El lobo persigue a Caperucita Roja, sufre el hechizo de la Luna llena; necesita que la niña le lleve hasta la casa de su abuelita, la única hechicera que conoce el antídoto a la maldición del hombre-lobo. El verano se tiene que marchar, el otoño acaba de llegar; sus destinos divergen; se conocieron una tarde de septiembre, mas nunca olvidarán sus efímeros y felices días juntos.
―¡Por favor, ayúdame a salir de aquí! ¡por favor! ¡no te haré nada! ¡por favor!… ¡Tengo hambre! ¿tienes algo de comer?… Aunque solo sea una mano –lloriqueaba la zombie cuando pasé junto a la boca de la alcantarilla de aquel oscuro callejón.
Se fue a vivir a una isla desierta y allí construyó gigantes y les dio vida siguiendo las instrucciones secretas escritas por el doctor Frankenstein, por fin hizo realidad su mayor anhelo; siempre había querido haber viajado a Brobdingnag. La llamada. Hace miles de años las piedras redondas cayeron del cielo. Desde entonces han aguardado pacientes la llamada. Hoy ha tenido lugar. El mensajero ha llegado. Las piedras se han activado. La misión ha comenzado. Temblad humanos, la reina ha despertado. «Recuerda que una buena novela (relato, cuento, microcuento, poesía, haiku…) no es para inhibirse del mundo presente (que también puede) sino, sobre todo, para aprender a vivir en él.» Surgen portentosas las diosas del profundo, ruge el mar bravío, hogar de lo innombrable, retador; nada osa interponerse al destino del nocturno. Sólo ellas conocen la culpa que dio lugar a su redención. ¡Escuchad, mares, atended, sabed que hoy no luce el sol! La nave salió del agujero de gusano. Habían despegado de la Tierra hacía tres días. La tripulación confirmó que el exoplaneta estaba donde habían calculado los droides de exploración. La Tierra estaba allí, el espacio es circular. Entre las olas. Al atardecer, cuando el sol se oculta y el sonido del mar reverbera y el viento de poniente levanta bruma, fíjate bien a lo lejos y verás a las sirenas saltar entre las olas. Puede que no te buscara cuando escribía, pero, sin duda, te encontré cuando me leíste. Me senté a la orilla de un arroyuelo y una cría de rana saltó del agua a mi mano y de allí a mi nariz, y recordé que, siendo niño, ya me sucedió una vez lo mismo; y, de nuevo, no pude parar de reír. Cuentan que hubo quien se enamoró de la luna y, de tanto contemplarla, llegó a aprenderse de memoria el nombre de cada uno de sus cráteres, ensenadas, valles…, cada insignificante hondonada, cada portentoso monte; amaba cada una de las arrugas de la bella dama. Me asomé a la ventana, hacía un estupendo día de primavera, a lo lejos se oían trinos en los árboles. En eso se posó un enorme escarabajo en el alfeizar, se acicaló las alas y volvió a alzar, portentoso, el vuelo. Según se iba me lo imaginé una nave interestelar. Y vi un cielo nubarróico, homérico, y, como si de un mar embravecido se tratara, las monstruosas nubes engulleron la ciudad y, tras su paso, todo fue nada. Dicen, los que sobrevivieron, que en los cúmulos se escuchaban bramidos; yo opino que eran demonios. Entre dos corchetes el piloto dirigió la nave con maestría, esquivó las comas y repostó en un punto y coma; allí retomó el viaje, se deslizó ingrávido por los puntos suspensivos… de letra en letra llegó hasta el punto final. Los actores se preparan, no sin nerviosismo, en sus camerinos. Es su más esperada actuación; aquella que hacen todas las noches, cuando los padres leen un cuento a sus hijos antes de dormir. Y es que los personajes de los cuentos infantiles actúan todas las noches. Su caso era similar al de Dorian Gray, aunque en esta ocasión lo que reflejaba su verdadera alma corrompida no era su retrato. Por eso no quería que le diese el sol, porque no quería que la gente viese su sombra.
Y la niña, sosteniendo la jaula abierta donde había estado su canario «Pichi», miró a su madre.
―¡Te he dicho mil veces que no picotees a deshora, hija!
―Es que tenía hambre, mamá –se excusó la pequeña, con su mirada inocente y su boca manchada de sangre.
El pueblo está en silencio. La gente en sus casas, o en lo que queda de ellas. Un perro olisquea entre las ruinas de los edificios. Los muertos ya comienzan a oler mal. Una niña llora en un rincón. Abraza fuerte a su osito de peluche. Suena una sirena. Otra bomba. Entré en la biblioteca a escondidas, cogí el libro y me escabullí en un rincón; allí, bajo una mesa, abrí el libro y comencé a leerlo. Cuando levanté la vista estaba en otro planeta. Le seguí el rastro en la nieve. Le tenía cerca, muy cerca. Casi podía olerle. Pero, tras la última huella, nada, la nieve inmaculada. Levanté la mirada y un trazo de luz atravesó la noche. El alienígena había logrado escapar. (de «Las crónicas de Atheru»)
―Y ésta es una ballena; es el animal más grande de la Tierra –le dije.
―¿El más grande?, pues en mi planeta existen los lerk.
―¿Y cómo son?
―Bueno… cómo explicártelo… un lerk se comería tres de ésas de un solo bocado –me respondió el alienígena.
La nueva atracción del zoo eran un par de ballenas. El público visitante no salía de su asombro; las miraba y no daba crédito.
―Mira, ¡vuelan!
Eran un regalo fruto de las nuevas relaciones diplomáticas con los recién contactados extraterrestres. Año 4572 d.C. Con los niveles de contaminación atmosférica dominantes, el producto más vendido es un par de pulmones que metabolizan los agentes nocivos del aire y los transforman en oxígeno de alta calidad. Los hay de tres tallas, según la demanda. Feo y enorme. Sí, es feo y enorme, y sí, la gente le odia porque ha matado a algunos, pero él sólo lo hizo para defenderse de las antorchas y las balas; pero a mí me trata bien, quizá porque le quiero. Lo que no me gusta es que le llamen la Cosa del pantano; no se lo merece. Los pasajeros en el andén. El tren llegó puntual. La estación estaba en el puerto espacial, rodeada de un campo de fuerza para garantizar la presión y el nivel de oxígeno. No había paredes, todo era espacio; la Tierra a lo lejos. El viaje a Madrid duraba una hora. El vehículo llegó a la estación de servicio. Allí le esperaba un amigo.
―¿Por qué has tardado tanto?
―¡Uf, no veas cómo estaba de tráfico el centro de la galaxia! Y el amigo se subió a la nave y se fueron por la autopista intergaláctica.
Mi primer amor. La primera vez que fui al teatro me colé por detrás; entré por debajo de la carpa del circo y me acurruqué entre bambalinas. Representaban «El sueño de una noche de verano». No me enteré de nada… pero me hipnotizó. Fue mi primer amor. Recuperando el paraíso. Desde un remoto lugar, la nave interestelar descendió en silencio. El alienígena buscaba algo en concreto, algo de inmenso valor. Cuando lo encontró, lo observó, acarició y olió con cariño: eran flores. En su planeta, la Tierra, ya no había. Eran las fiestas del pueblo. La plaza estaba a rebosar de gente. Comenzó a sonar la música y también comenzó a llover. Algunas parejas se fueron a los soportales, otras sacaron su paraguas y siguieron bailando. Sólo tú y yo bailamos sin paraguas. «En un agujero en el suelo, vivía un hobbit»… En su madriguera, bajo tierra, a los pies de un gigantesco árbol milenario, el conejo, antes de ir a dormir, leía un poco; ahora tenía en sus manos su libro preferido: «El hobbit»; Bilbo era su héroe predilecto. La bruja baja al sótano de su casa, cierra la puerta, se va a la librería a por su libro, lo abre y lee el conjuro. A la casa le crecen patas de gallina gigantes. Algo ha ido mal otra vez: «¡Diablos, nunca consigo que le crezcan alas!», exclama. Era un planeta a dos niveles, como si la piel de una naranja estuviera separada de la carne de la propia naranja, pues así. En el nivel superior vivían los ricos: había mejores vistas, el aire más puro, se vivía mejor y todo eso, ya sabéis; en el de abajo los pobres. Primero inventó el motor antigravitatorio, después el tractor volador; por fin pudo arar el cielo y cosechar las nubes de algodón dulce. El vendedor de aquella pequeña tienda de libros contaba historias increíbles a los clientes: viajes interestelares a exóticos planetas donde luchaba contra monstruos de otra dimensión… Los clientes alababan su imaginación; lo que no sabían es que todo era cierto. La joven y su robot. Cuando algún amigo íntimo pasaba la noche con ella, el robot les atendía sirviendo la cena… y luego se iba a su cuarto. Estaba enamorado de la joven, pero ella no lo sabía pues no se le notaba; el robot no tenía glándulas lagrimales pero lloraba en silencio. En una esquina, junto al parque, un niño sentado en un banco; junto a él una caja de madera llena de paja. En la caja, seis cachorritos dálmata y un cartel que pone: «Se regalan». No he podido remediarlo: me los he llevado todos. A ver cómo lo explico en casa…

Mes 5.

Mas, tras el escaparate, un salvaje vórtice de libros volando directos hacia mí. Persiguiendo a mi perro llego a un callejón. La pared de ladrillos, alta, inexpugnable. En eso se abre un círculo y a su través veo un hermoso jardín, de árboles altos y dragones en el cielo. Entro. El círculo se cierra. «¡Hola!», grito. Nadie contesta. ¿Estoy solo?
―¿Por qué escribes si no te lee (casi) nadie?
―Alguien habrá.
«El rey os creó libres, ¡no lo soporto! Escucha, humano: la imaginación es fruto del don de la libertad que sólo la humanidad poseéis. Yo no puedo acabar con vuestra libertad, no directamente, pero puedo persuadiros para que queráis acabar con ella.» La rabia le consume. «El poder del rey reside en su amor a sus hijos, como él os llama, y donde mejor se manifiesta es en vuestra opción de ser libres. Y su tesoro: vuestra imaginación que crea mundos; sois cocreadores, aunque no seáis conscientes de ello.» Su voz rota, los puños cerrados. Su mirada torva, sus ojos aviesos. «Por eso quise que destruyeras el fruto admirable de vuestra imaginación, pues sin frutos el árbol se agosta y muere; así, sin todo esto que ves, sin todo lo que te rodea, la libertad se marchita y acaba por desaparecer.» El rey me mira y asiente. Y regreso a la pared de ladrillos y se abre un círculo. Salgo. El círculo se cierra. Vuelvo a estar en el callejón. Mi perro me está aguardando y se alegra al verme. Crestas blancas. Paseando por la costa, al atardecer malva de un tres de mayo cualquiera, levanté la vista, respiré hondo, extendí los brazos y volé sobre el mar; las olas bravas me despidieron agitando la espuma sobre sus crestas blancas. Palabras esdrújulas. Recuerdo aquel atardecer de abril, con el sol naranja entre nubes rojo burdeos, en el taller del sótano de mi casa, jugando con mi nuevo robot a ver quién encontraba más palabras esdrújulas. Ni que decir tiene que ganó él, claro. Leer está bien, muy bien, pero releer está mejor; volver a pasear por senderos ya conocidos, volver a reconocer aquellas agradables sensaciones que una vez leíste, reencontrarte con viejos amigos, volver a vivir sus vidas, sus aventuras. Me perdí en el quinto pimiento. Buscaba la seta donde vive mi cuñado: es un duende acomodado. Pero tomé un desvío erróneo.
Me perdí en Marte y, de la rabia, lancé un zapato al suelo: salió volando, y la falta de gr av ed a d lo en v ió a l in f in it                                                                                                         o.
Intrépida. Era una sirena que disfrutaba agarrándose a una ballena y dejándose arrastrar hacia lo más profundo del océano. Mi madre siempre fue muy intrépida. Ya no me asusto. Desde que ya no me asusto, el monstruo que vive bajo mi cama se aburre; en ocasiones le cuento cuentos de miedo y se ríe. Lección de humildad. El pequeño roedor se quejaba siempre ante Dios por ser tan insignificante. Sin embargo, un día, un gigantesco meteorito se estrelló contra la tierra y los dinosaurios se extinguieron; pero el roedor siguió viviendo: no volvió a quejarse nunca más. Mi primer trabajo. Cuando terminé el colegio no tenía muy claro qué estudiar ni qué profesión elegiría; por eso me sorprendí cuando tuve mi primer trabajo y comprobé que se me daba tan bien; al fin y al cabo no todo el mundo es capaz de matar vampiros. Novedad. Con luna llena o mejor sin ella busca nuevas experiencias que hagan menos tediosa su noche inmortal. En aquella ocasión, junto a la catedral, el vampiro observa desde la sombra y aguarda a que llegue un ángel; le han dicho que son los de sangre más sabrosa.

En la pradera de espigas amarillas
corre el perro persiguiendo mariposas;
no se le ven las patas.

En un rincón de la iglesia reza una mujer anciana: los ojos cerrados, juntas sus manos arrugadas tras millones de horas de duro trabajo; a Dios rogando y con el mazo dando.
Me gusta el tono azul al atardecer, el verde césped del prado verde, los trazos de rojo Venecia del cielo mientras el sol juega y se esconde; y entre las ramas de los árboles, los gorjeos de los pájaros. En un viejo tablero de ajedrez la Vida y la Muerte juegan al atardecer; sin prisa, pero sin pausa. A veces gana uno, a veces el otro. Se conocen bien; llevan juntos mucho tiempo… desde que el tiempo es tiempo. Justo antes de que el sol de mayo se oculte bajo tierra, algunos pájaros aún vuelan raudos; ¡es hora de cenar! Sus chillidos resuenan eternos. Entre una estrella y otra, dos milímetros, o menos; y, sin embargo, dos años luz, o más. Me gusta la claridad del cielo que anuncia lluvia torrencial. El atardecer borroso del aguacero. El perfume del aire mojado. La luminosidad tras la tormenta. El arcoíris. Que tu pulso no tiemble, la espada de plasma firme, la mirada digna; que lo que escribas en el libro de tu existencia te sea tomado en beneficio cuando llegue tu hora.
Cazador de leones.
―En una ocasión conocí un duende del bosque que cazaba leones.
―Los duendes son demasiado pequeños para cazar leones.
―Pues él llevaba al cuello un collar, y cuando le pregunté de qué era me respondió: «Son dientes de león.»
Todas las noches los fantasmas recorren anhelantes los pasillos y habitaciones con la esperanza de que alguien haya, por fin, restaurado su vieja casa abandonada.
Demonios duende.
―En una ocasión conocí un demonio duende.
―No existen los demonios duende.
―Pues oí como un hada del bosque le gritaba: «¡Duende del demonio, no quiero volver a verte!»
Trolls.
―En una ocasión conocí un troll duende.
―No existen los trolls duende.
―Pues en la reunión social a la que asistí la pasada noche de plenilunio fui testigo de cómo un duende claramente le echaba en cara a otro que estaba muy mal ser un troll.
―Alrededor de aquella estrella azul, ¿la ves?, hay un planeta donde habitan ogros que cabalgan elefantes voladores.
Mi amigo se creyó que le contaba un cuento. Cuando me quedé solo me fui al sótano a seguir sacando brillo a las medallas que había ganado en aquellas carreras aéreas.
¿Por qué los vagones de tren descartados por la sociedad tienden a agruparse en descampados a las afueras de la ciudad?, ¿por qué ese aire triste?, ¿por qué se sienten tan solos a pesar de estar tantos juntos? Cuando inventaron los motores antigravitatorio, esos capaces de desplazarse sin tocar el suelo, los primeros que lo agradecieron fueron los barcos inteligentes; llevaban tiempo queriendo ver el interior de los países, sus montañas, sus centros históricos… Viendo aquellos chiquillos corriendo y riendo sin parar me recuerdan a mí cuando, de joven, me comportaba irreflexivo. Hice muchas locuras, ¡la de guerras que provoqué! Pero he cambiado; la edad, supongo. Hice bien en huir de mi planeta natal y venir a la Tierra. En un rincón, entre los grandes almacenes y las sucursales bancarias, el hombre pide limosna. Es un buen sitio, en medio del trajín de la ciudad, y el sintecho consigue más dinero que antes; desde que los robots sustituyeron a los humanos en sus puestos de trabajo. Desde que vino a vivir a la ciudad el conejo blanco ya no va a todas partes corriendo, va en tren; pero aún sigue llegando tarde. «La vida, que sigue igual», se dice. Sentado en un banco veía pasar a la gente, «yo soy uno de ellos», pensaba; y entonces volvía a leer el relato que estaba escribiendo y reía. «¡Qué va!», se decía. Los pasajeros aguardan su llegada en la estación. El tren, como serpiente voladora, deslizándose entre las nubes; su motor antigravitatorio le traslada en silencio, veloz, zigzagueante. Desciende fugaz, puntual. La tecnología avanza que es una barbaridad. Hago ballenas con papiroflexia, las deposito en el agua, normalmente al amanecer, flotando en la superficie y luego leo el conjuro y las dejo que buceen mar adentro; antes de desaparecer me saludan respirando hondo y expulsando un chorro de agua. Yo sonrío.
¿Ves aquella estrella blanca?, pues en uno de sus planetas viven unas bellas criaturas acuáticas. Cuando estuve allí, yo las llamaba sirenas; pero «las sirenas nunca han existido en la Tierra, y nosotras sí somos reales», me decían, mientras jugábamos en el agua. Vivo en una ciudad sin mar pero ayer buceé entre peces, y no en el Zoo Aquarium. Compré material de albañilería, sellé las juntas de las puertas y ventanas de mi casa y la inundé de agua hasta el techo. No entiendo por qué se quejó mi vecino por unas minigoteras. Sí, lo sé, tenía que haber aislado también el suelo, pero se me pasó, culpa mía; ya le arreglé las goteras al vecino. Lo tendré en cuenta la próxima vez porque me gustaría comprar algunas crías de tiburón. Lo que no sé es cómo salir de casa sin inundar la escalera. Cuando me miro al espejo me desdoblo en dos: en el yo que mira y en el yo que es mirado que mira al que le mira. Cuando sonrío, aquel me sonríe; cuando lloro, aquel me llora. Si salto, aquel me mira perplejo; pero si le hago burlas, aquel saca la cabeza y me ruge. No tengo miedo. No tengo miedo. No tengo miedo. No temo la oscuridad, ni esa risa siniestra que me persigue. No. Ni los monstruos que salen de las paredes. Ni los cadáveres. ¡No!, no… no le veo la gracia. Es la última vez que entro en la Casa del Terror del parque. Trabajo en equipo. La ballena azul se dirigía directamente al banco de krill. En cuanto estuvo a su alcance abrió su enorme boca y se dispuso a darse un festín. En eso el banco abrió la boca y se tragó a la ballena. Moraleja: No subestimes el trabajo en equipo.
El dinosaurio y el roedor. El dinosaurio amenazó al roedor:
―¡Ni se te ocurra molestarme o te aplastaré de un pisotón!
―Te aseguro que soy el menor de tus problemas –le respondió el roedor al mirar al cielo y ver llegar el meteorito.
―¿Por qué no han llegado aún los extraterrestres?
―Nos consideran una especie venenosa.
―¿Por?
―En la naturaleza, los animales y plantas más peligrosos y venenosos suelen ser los más hermosos.
―¿Y?
―Vista desde el espacio la Tierra es el más hermoso de los planetas.
Necesitaba algo que me animara, hastiado de verlo todo a ras de suelo, así que subí a mi nave y ascendí sobre las nubes y más allá; viajé lejos, hasta aquella estrella, y volví la vista: todo cambió; sólo necesitaba observar la Tierra desde el espacio exterior. Si un país (sus habitantes, se entiende) está bien alimentado, ¿es un paisano?
No sabemos lo que somos,
pero sí sabemos lo que queremos ser;
mas nunca seremos lo que queremos ser
y desperdiciaremos lo que somos.
El río corta el valle entre montes escarpados, el agua torrencial brama y rompe las rocas a su paso; en el cielo los dragones sobrevuelan entre nubes blancas y de sus bocas rugientes brotan llamaradas de fuego y odio. El cazador, en un risco, acecha con su ballesta. Visto desde el espacio era un simple planeta helado, evidentemente inhabitable para los humanos; no había agua, ni oxígeno, sólo hielo de cianuro. Bajo el hielo, aquellos seres mitad pez mitad otra cosa, pero inteligentes, vivían en paz, sin embargo.
El baúl grande.
―Mi padre me decía que lo más pesado de ir de vacaciones era tener que llevar el baúl grande.
―¿Tanta ropa llevaba?
―Oh, no, la ropa la llevaba en una pequeña maleta de mano; el baúl era para los libros que leería durante las vacaciones.
¿Has visto cómo las ballenas saltan fuera del agua como intentando volar? Pues es la herencia genética de sus antepasados, cuando llegaron a la Tierra procedentes de su planeta natal; allí volaban de verdad. Entre las escarpadas montañas nevadas, allí donde no podían acceder aquellas sanguinarias criaturas llegadas de otros mundos, la resistencia humana lanzaba sus últimos jets, sus últimas bombas, con la esperanza de destruir aquella nave, «la que todo lo controla». Toma de muestras. Aquella mariposa blanca con motas negras no hacía más que posarse en el hombro de los veraneantes que tomaban el sol junto al lago. Era la mejor opción para estudiar a los humanos, tomar muestras de sangre y sudor, y el alienígena lo sabía. Últimamente no sé a qué estrella viajar, las más cercanas, con sus planetas circundantes, ya los he visitado varias veces, para las más lejanas no me da más de sí mi nave espacial; voy a tener que inventar un nuevo propulsor antigravitatorio si quiero ir más lejos. Cuando ya sólo trabajaban robots en la cadena de montaje de los nuevos coches dejaron de fabricar utilitarios y se especializaron en deportivos, de los caros. Los robots tenían más aspiraciones y gustos mucho más caros que los humanos. El joven se apartó a un rincón y comenzó a llorar. El técnico se le quedó mirando y llamó a Mantenimiento. «Está llorando», les dijo. Vinieron y se lo llevaron para examinarlo. Aún no comprendían del todo cómo era posible que sintiera aflicción: era un robot. Tras la guerra todo quedó malogrado: los mares hirvieron, la tierra se pudrió. Bueno, todo no, las carreteras y autopistas fueron reconvertidas en tierras de labranza, era la única opción para sobrevivir; el asfalto había servido de aislante contra la radiación. Yo no he perdido aún la esperanza, ni mucho menos; siempre que veo un armario entro en él esperando encontrar la entrada a Narnia. Al amanecer, cuando salía a pasear o cuando se paraba a conversar con alguien en la calle era como uno más de nosotros. Al atardecer, al regresar a casa, se encaramaba a los muebles y andaba por el techo a cuatro patas, acechando, salivando. Por la noche cazaba. ¡Jopé con las vecinas! Por cierto, ¿el paleontólogo no se llamaría Fulgencio, verdad?; es que tengo un primo que trabaja en el Dinópolis que se llama Fulgencio. ¿Era él?, por favor, dime que no, que me debía dinero.
Cosas de familia.
―Mi abuelo murió por un rayo.
―¿Intentó protegerse de la tormenta bajo un árbol y le cayó encima?
―No, por un rayo de sol. Era un vampiro.
Refugio.
En una esquina perdida han abierto una pequeña librería de libros olvidados. Allí encuentran refugio los dragones.
Lucha a muerte.
―Cuentan que los estorninos y los dragones lucharon a muerte.
―¿Y quién ganó?
―¿Has visto algún dragón?
Previsor.
El satélite de última generación cartografiaba el espacio y estaba pilotado por un robot capaz de imaginar las más sorprendentes soluciones a cualquier problema que surgiera en el viaje; por ello iba dejando miguitas de pan por el camino, para no perderse.
Muy decidido, un niño de unos diez años se acerca al mostrador de la biblioteca del barrio y le dice a la bibliotecaria:
―Hola, quiero un libro. Es de cuentos. No me acuerdo cómo se llama, pero estoy seguro que comenzaba por «érase una vez…». ¿Lo tienen?
Gatos, perros, pájaros, loros, hasta dodos, ¡los echaba de menos a todos ellos!; a las personas no las aguantaba: sus envidias, sus falsas apariencias… Por eso, en ocasiones, agitaba su varita, pronunciaba el conjuro y transformaba a todos sus vecinos en animales. «En confianza, yo no cumplo años, no lo hago desde hace mucho, exactamente desde hace 375 años; desde entonces siempre tengo 52, pero no se lo digáis a nadie, ¿eh?», les decía el vampiro a sus amigos. Tras la tercera guerra mundial la humanidad se extinguió. Los animales, los árboles y demás plantas se alegraron; sabían que al final ganarían, sabían que su técnica de «espera y sé paciente, que se maten entre ellos» tendría éxito.
―¿Qué te llevarías a una isla desierta?
―Creo que con una docena de personas tendría suficiente.
―¿Y eso?
―Si no, ¿a quién le chuparía la sangre? –contestó el vampiro.
Bueno, todavía está a tiempo, pues sólo al borde del precipicio se nos ocurren ideas para escalar la montaña. Las señales están ahí, avisando, advirtiendo, sólo hay que mirar, darnos cuenta de ellas y actuar en consecuencia. Luego no vale eso de «es que no lo vi llegar», o eso de «pensé que sólo estaba jugando», o incluso aquello de «pensé que ya se le pasaría, que era cosa de la edad»; porque no, no se le pasa, y luego pasa lo que pasa, que llegan los arrepentimientos y las lamentaciones y para entonces la cosa ya no tiene solución. Porque la rebeldía no es una enfermedad, sino un síntoma, y hay dos opciones: o cerrar los ojos «y que sea lo que Dios quiera», abandonando a su suerte a la fantasiosa Jolly, o abrir los ojos, apoyar el hombro, poner manos a la obra y ayudar a quien está pidiendo ayuda aún sin saberlo; y si para eso hay que dejar que flete un barco pirata y se eche a la mar pues se hace y punto, pero no sin antes hacerle saber a la señorita Roger que estás siempre a su lado y que puede contar contigo para lo que necesite. Y una vez más, Patricia, abres camino; genial, como siempre. ¡Enhorabuena! Es una de esas casas que se construyen en los árboles para que jueguen los niños; entre sus paredes, sin embargo, también sobreviven fantasmas. Aquella noche, negra, y mi sombra perdida en la oscuridad jugando al escondite conmigo; la luna en blanco observa: «¡eh, yo también juego!», parece querer decir sonriente. Siempre me han gustado los coches y los aviones. Por eso me encanta que hayan inventado el motor antigravitatorio, pues ahora los coches puedan volar. Se levantó envuelto en vendas. Cuando se durmió era un dios, temido, amado, odiado, su palabra era ley; ahora que el conjuro le ha despertado es sólo una atracción turística. Al menos ahora todos querían hacerse un selfie con él y eso le gustaba al faraón. Nunca fui consciente de mis errores, hasta que me aseguraste que no los tenía. Llueve, miro a lo lejos, a aquellos árboles verdes del fondo, ante mis ojos millones de gotitas caen raudas creando una suave cortina; respiro hondo, mis ojos se humedecen. Paseo por la calle, la gente a mi alrededor, sin darme cuenta, el murmullo me engulle; me detengo ante un escaparate, alguien tira una piedra, el cristal roto, me veo roto; sigo andando, unas palomas alzan el vuelo a mi paso, quisiera tener alas, volar con ellas. Las nubes blandas, el cielo encapotado, alzo la vista, pasan sobre mí puntos fugaces, pájaros en vuelo; entre árboles mojados me pierdo, charcos me acorralan, piedras en el suelo; un piar incesante me sobresalta, el escalón de la acera me asemeja un precipicio. La playa desierta, silencio roto por las olas y las aves, una ola viene y se va, otra viene y se va, otra, sus rastros duran segundos en la arena; mis pies mojados, tocando el cielo creo ver sirenas saltando sobre el mar adentro, el sol del atardecer me hace señas. Oh, no, a sus primos nunca les deja ni tocar a su querida mascota, ni hablar, siempre que vienen de visita o a pasar las vacaciones juntos –porque todos los años se junta toda la familia y van a la playa, o a la montaña, o a casa de los abuelos maternos que viven muy lejos pero no se acuerda del nombre de la ciudad donde viven porque es un nombre muy largo de otro idioma, o a casa de sus abuelos paternos que viven en Cuenca–, pues eso, que nunca les deja que toquen a su querido oso panda; cuando llegan lo esconde en un escondite secreto que sólo ella conoce, y allí lo deja hasta que sus primos se van de casa, así que no hay problema, ella sabe defenderse de sus primos, y eso que es la más pequeña de todos, pero… ¡cualquiera se atreve a hacerla rabiar! El sol rojo, las paredes desconchadas, una niña de siete años toca el violín, un niño de seis le aplaude sentado en una silla destartalada, el suelo de piedras rotas, sus ropas sucias; un gato negro salta, corretea, una bomba cayendo, todo explota, guerra, muerte. Palabras sin sentido, un árbol en el canto de un libro, una paleta de colores acorrala un río, niebla sin límite, al fondo un rugido; brújula de tres agujas, «beware of well… just beware», gafas con las que ver el tiempo, mi nave mis reglas, ¿palabras sin sentido? Sentimientos: negativos: tristeza, tristeza, hostilidad, frustración, ira, desesperanza, culpa, celos; positivos: felicidad, humor, alegría, amor, gratitud, esperanza; neutros: compasión, sorpresa. Le gustaba viajar con poco equipaje, zapatos cómodos y en su bolso de mano la cría de dragón que encontró en aquel bosque. En la playa hacía vela y submarinismo; allí conoció a su esposa: hermosa, con esos ojos verdes y sus largas aletas de sirena. Comer con las manos.
―He alquilado una habitación en mi casa a un alienígena que come con las manos. ―¡Hombre, eso tampoco es tan malo!
―Es que come literalmente con las manos; sus uñas son sus dientes.

Mes 6.

Garabatos. Escribía garabatos, es cierto, pero la gente le aclamaba asegurando que era literatura; el escritor no salía de su asombro, ¡oh misterio!, pues cuando escribía literatura la gente se espantaba asegurando que sólo eran garabatos. Entre llamada y llamada, el sereno escribía cuentos de fantasmas; era un experto en ánimas pues él mismo lo era. Cuando el museo cerraba, las estatuas hacían flexiones y abdominales para desentumecerse. Aquel pequeño cine de barrio abandonado, donde los personajes de las viejas películas ya olvidadas comen palomitas y cucarachas mientras, sentados en las polvorientas butacas, ven películas de Frankenstein y de Drácula y aplauden entusiasmados.
―Lloras, ¿duele?
―Sí, pero estamos creando un recuerdo.
Son las 22h. Tras todo el día en la cocina de un restaurante de mala muerte la mujer regresa agotada. En casa la espera Pluto. Al verla ladra y mueve la cola. «¡Vamos, Pluto, a pasear!; ¿estás contento?», y salen de casa; las farolas lucen, la calle vacía, silencio. Japón o cualquier otro lugar. Un callejón estrecho, abarrotado de pequeños bares con el mostrador en la misma callejuela. Luces, muchas luces, anuncios, muchos anuncios, el olor a comida, el aroma a pescado crudo, mucho cuchicheo; pero de gente que se siente sola. Es verano, hace calor, los pájaros pían, los insectos invaden el campo, las espigas miden ya casi un metro. Marcia pasea despacio, se sienta en el suelo, desde lejos no se la ve pues las espigas son más altas; y allí, en un pequeño cuaderno, escribe cuentos de hadas. Cuando veía que alguna persona se acercaba peligrosamente se quedaba quieto como un árbol y esperaba a que se fuera. Sus largas patas y su piel agrietada color corteza seca eran perfectas para camuflarse; así sucede desde hace siglos, desde que el dragón habita allí. El robot le miraba y se preguntaba por qué el humano necesitaba llorar. El tren se puso en marcha. El cielo de tormenta, las nubes negras, relámpagos, un estruendo descomunal y una piedra de fuego del tamaño de una ciudad apareció incandescente cayendo del cielo; aquellas vistas desde la ventanilla fue lo último que vio. Se despertó en una diligencia sin caballos, ¡cómo había llegado allí! El suelo tembló, un gigante tan alto como un edificio de diez plantas surgió corriendo y en un par de zancadas le alcanzó; aquellas vistas desde la ventanilla fue lo último que vio. Llevaba tres meses de vuelo interestelar y en eso el propulsor estalló, la nave parecía una cometa con esa cola de humo, el planeta se acercaba a velocidad supersónica, cerca, muy cerca…; aquellas vistas desde la ventanilla fue lo último que vio. Me vinieron a buscar según lo programado, llevaba toda la información necesaria. La nave de reconocimiento aterrizó en silencio una tarde de mayo algo nuboso. Ya echaba de menos a los míos. La próxima vez que regresara a la Tierra lo haría en una nave de exterminio. Aquel año fue muy extraño, nadie en el geriátrico murió, y eso que durante los años anteriores se había alcanzado una media de ocho fallecimientos; y es que, cansada de la rutina de su trabajo, la Muerte se tomó un año sabático para ir a la playa a descansar. Aquel verano fue muy extraño, los salvavidas de la playa no dieron abasto: entre julio y septiembre hubieron veinte fallecimientos, cuando otros años no se alcanzaron de media ni los cinco; finalmente le tuvieron que rogar a la Muerte que regresara al geriátrico. Por el camino abandoné mi armadura, mi casco, mi escudo y hasta mi espada; rechacé lo que fui, anhelando olvidar mi estéril pasado de guerra; deambulando por la playa, en la arena dejé mis huellas en busca de un lugar donde habitar, por fin, en paz. Existe un lugar al norte que no aparece en los mapas donde habitan monstruos, gigantes, y esos descomunales peces con los que se alimentan. Es una zona «top secret»; sólo lo sé yo, y ahora tú, así que guarda el secreto o tendré que matarte.
―¿Éste es el submarino de camuflaje?
―Sí.
―¿Y pasará desapercibido siendo tan enorme?
―No se preocupe, tras las últimas pruebas nucleares, los monstruos que pueblan los mares son tan descomunales que, a su lado, vamos a parecer sardinas.
Uno de miedo. Cuando yo era pequeño, mi padre me contaba cuentos antes de dormir. «¡Cuéntame uno de miedo!», le pedía yo insistentemente. «No, que luego tienes pesadillas», me contestaba; aunque yo sabía que no lo hacía porque el que tenía pesadillas luego era él. Fuera de lugar. Caminaba despacio, de habitación en habitación, confiando que no le escucharan los dueños de la casa, sobre todo los niños; ya no tenía edad para sus chiquilladas. Sí, ya sé que estaba fuera de lugar, pero es que era un fantasma algo tímido. El monstruo de Frankenstein es pariente del hombre-lobo por parte de pierna derecha. Romper la tierra. El niño tiró la piedra al agua y ésta rebotó y rebotó y rebotó… hasta golpear la montaña y romper la Tierra. Era el telescopio espacial más potente de la historia de la astronáutica, capaz de detectar una mosca a un millón de años luz. Un día la Tierra recibió una notificación judicial de parte de unos extraterrestres, acusándonos de voyeurismo. Mis gatos a veces se creen astronautas, y en mi cabeza aterrizan; primero se suben al armario, que toman por su estación espacial, y, ¡zas!, dan el salto. El niño coloca su osito de peliche sobre el muro bajo de piedras grandes; «espera aquí, ya verás», le dice, y da un pequeño silbido. En eso un petirrojo se acerca de no se sabe dónde y, agitando sus alitas, se detiene ante el niño. «¿Ves?, ya te dije que vendría». Dibujé un globo en la pared de ladrillos y ésta tembló y uno tras otro despegaron hacia el cielo como una bandada de palomas que rompen la formación en tierra y alzan el vuelo; y, alargué el brazo, agarré uno de ellos, cerré los ojos y, cuando los abrí, volaba. Entre árboles frondosos y arbustos en flor leo, alojando en mi memoria otro libro más; ya no me importa que los bomberos quemen mi casa y todos mis libros, pues ya viven en mí. Llegué al abrevadero, y allí estaba: el grifo; no perdí el tiempo y, sin pensármelo dos veces, allí fui y, de un salto, me encaramé a él dispuesto a volar, si era menester. Entonces llegó mi esposa: «¿se puede saber qué haces sobre el grifo del fregadero?», me dijo. Los coches hacían cola frente al nuevo concesionario. Con el nuevo plan renove, a cambio del viejo coche de ruedas y gasolina, se ofrecía por un módico precio un elegante coche aerodeslizador de propulsor antigravitatorio; «el futuro, hoy», anunciaban. La obra de teatro terminó, el telón bajó, las luces se encendieron, y los espectadores fueron saliendo a la calle. Mientras aquel matrimonio se levantaba, la esposa miró a la joven del palco; la joven sabía perfectamente lo que significaba aquella sonrisa. La joven aguardaba camuflada en una esquina oscura, en silencio, sus afilados dientes ansiaban sangre; al verle acercarse sonrió. Aquel muchacho no tuvo tiempo de escapar cuando la joven se le echó encima, aunque sabía perfectamente lo que significaba aquella sonrisa. En la rueda de reconocimiento los sospechosos, serios, guardaban silencio, con la vista al frente y las manos en los costados; todos menos uno que, burlón, sonreía taimadamente; el comisario sabía perfectamente lo que significaba aquella sonrisa. Se casaron un hermoso día de cuento de hadas, pero a nadie extrañó que, a los postres, se organizara la de san Quintín. Hubo heridos, incluyendo a los policías que protegían a los novios: ella una gigante, él un ogro; y es que sus familias nunca se han llevado bien.
Despedida. Escríbame una carta, monsieur, me gustan sus cartas. Consejo. Dicen que una imagen vale más que mil palabras; ¡imagínate una sonrisa! Se tomaron de la mano frente al abismo, debían hacerlo si apreciaban en algo su vida; justo cuando dieron el salto el aliento de la bestia rozó sus nucas. Habían vencido, habían logrado la gema mágica. Abajo la profundidad del río les permitió escapar ilesos. Entré en la sala. El capo jefe, sentado al fondo, tras su mesa; sus esbirros: uno a mi derecha, bebiendo en el bar; a mi izquierda, dos, engrasando sus pistolas; el cuarto es el que me ha abierto la puerta. Total: 28 segundos. Eso es lo que tardé en matarlos. Van en furgoneta negra, los cristales tintados. Usan gafas negras. Podrían hacerse pasar por policía secreta, pero no. Ellos buscan inmigrantes, inmigrantes ilegales. Aquellos ilegales procedentes de otros planetas. Los legales son bienvenidos. Ya están aquí. Al atardecer viene a la playa y, mar adentro, se divierte bañándose y jugando con los delfines que, curiosos, se le acercan juguetones. El visitante vive lejos, pero no le importa hacer el viaje desde su casa; su nave espacial es muy veloz. En su planeta no hay mar. Cuando era pequeño tenía miedo del monstruo de debajo de mi cama. Al crecer se marchó de casa al ver que ya no le temía. Veinte años después me hice astronauta; al llegar a Marte me estaba esperando allí. Me alegré al volverle a ver. Tras reunir toda la información para la invasión, el alienígena activó el propulsor de su camuflada nave espacial y despegó a la velocidad de la luz, desapareciendo entre las estrellas. Ante su ausencia, el gobierno francés ha decidido construir otra torre Eiffel.
«―Así puedes hablarme de tus libros, ¿de qué va éste?
―Ah, va de un…tío que se cree que es un caballero andante, sólo que vive en un mundo en el que los caballeros ya no existen.
―Eso se parece a mi mundo.»
En mis viajes por tierras lejanas, una vez escalé una montaña alta y en su cima encontré una aldea cuyos habitantes, además de recordar el pasado, podían recordar el futuro. Cuando les dije que yo no podía recordar el futuro, les di lástima. A mí no me la dio.
―Se ha colado la pelota debajo de aquel camión –me dijo mi amigo.
Y yo miraba y veía un dragón incubando su huevo; en el trabajo me llamaban Quijote.
Una palabra es más que un trazo en un papel, más que un sonido al hablar, mucho más que una idea, es una creación, un milagro, porque las palabras crean; hagamos, entonces, cosas buenas con ellas. Sentado sobre una roca, cerré las manos enterradas en la arena; me puso en pie, apreté los puños y, al abrirlos, entre humo blanco revolotearon mariposas azules. Sólo en momentos como ese imaginaba estar de vuelta en casa, allá lejos, en mi lejano planeta. A veces pinto acuarelas. En ocasiones, al terminar el cuadro, me gusta más cómo ha quedado la paleta que el propio lienzo. Es como si aquel desorden de manchas conectara más conmigo, tuviera más de mí; tanto que, al final, enmarco la paleta y lavo el lienzo. ¡Mil gracias, señora! Vos tampoco lo hacéis nada mal; ¡vive Dios que me agradan vuestras reseñas, pardiez! Y andad con Dios, y mucho de enhorabuena. «Si yo, por malos de mis pecados, me encuentro por ahí con algún gigante, quién duda sino que en los venideros tiempos, a la razón de la sinrazón que a mi razón se hace; y dichosa edad, y siglo dichoso aquel adonde saldrán a luz las famosas hazañas mías: pues yo sé quién soy.»
―Caballero don Luis del Paraíso, si por designio del sabio encantador Frestón, os partiese en dos de un mandoble un fementido jayán, con mis mesmas manos os serviré dos tragos del bálsamo de Fierabrás, y quedaréis más sano que una manzana del Edén, si me permitís la sinonimia.
―Permítola, permítola, sin duda, y es más, amable dama Carmen, si en tal estado me viera, no por culpa mía sino por la del cruel destino, seguro me tengo que vuestra maestría culinaria en la elaboración del sagrado bálsamo sanaría todo mal mío. Agradecido, quedo siempre suyo. P.D.: Gustóme fablar con vos sin las priesas destos tumultuosos tiempos, ¡vive Dios!
Al pasar junto a la casa abandonada, vi en los sucios ventanales que aún quedaban –pocos ya– signos en apariencia incomprensibles. Me acerqué curioso y entendí que eran fórmulas matemáticas de insospechado valor. «Es que allí vivió y murió un científico», me dijeron. Nuestra insensatez provocó el calentamiento global, y éste originó la lucha a muerte por el poco agua que quedaba; al final los mares se secaron, los ríos sólo fueron un recuerdo. Fue en Venecia donde inventaron los motores antigravitatorios; para las góndolas, sabes. Los acorazados alienígenas huían despendolados ante la acometida humana, y don Quijote, creyéndoles gigantes, les gritaba: «¡Non fuyades, cobardes y viles criaturas!»; su mirada altiva, sus ojos centelleantes con aquella puesta de sol. El bálsamo de Fierabrás hace efecto, ¡vive Dios si cura a los caballeros!, dos gotas hacen falta, sólo dos; y cuando aquella somanta de palos me tomé medio frasco, ¡impetuoso! Y aquí estoy ahora, ¡inmortal!, en pleno siglo XXXVI, buscando gigantes. De tanto leer y tan poco dormir llegó a creerse la más valerosa, audaz, intrépida y heroica de las damas andantes que jamás existiera; lástima que en el siglo XLIII ya no hubiera gigantes, aunque al menos había alienígenas. ¡El muy truhán! El niño creció, y, el día en que dejó de temer dormir a oscuras, el monstruo que vivía bajo su cama se tomó vacaciones. Ahora que el niño ya es mayor y escribe cuentos ha vuelto junto a él y disfruta ahuyentando a sus musas, el muy truhán. El faro en la tormenta. El faro se vio zarandeado violentamente por la tormenta. El farero, acostumbrado a tales imprevistos, enfocó la luz y gritó: «¡Eh, tú, deja de agitar la botella!» La tormenta cesó cuando el borracho obedeció y la dejó en la mesa. Incomprensión.
―¡He visto un dragón!
―Sí, claro que sí. Acompáñenos.
En medio de la vía del tren vi una chica que sostenía un espejo en el que aparecía una chica que sostenía un espejo en el que aparecía una chica que sostenía un espejo en el que aparecía una chica que sostenía un espejo en el que aparecía una chica, y tuve miedo. ¿Mi planeta favorito?… oh, sí, por supuesto, es uno pequeño, de cuyo nombre no quiero acordarme… más que nada para que no lo estropeen los turistas. Está habitado, sí, pero pronto se extinguirán, sin duda; cuando eso suceda me iré a vivir allí. Es el paraíso. Era una tienda sin importancia, perdida en un rincón de un callejón perdido en el atestado centro de la gran ciudad; la gente pasaba a su lado ignorándola. Pero en ella aún se vendían libros. En aquella cordillera los alienígenas camuflaron el dispositivo. Su misión: estudiar la evolución de los nativos, y, en caso de que cometieran el pecado imperdonable de la guerra, alcanzada la capacidad del dominio nuclear, destruir el planeta Tierra. Cuentan que un gorrión pasó volando junto a un edificio muy alto y elegante, de esos de los de antes.
―Yo también quisiera volar –le dijo el edificio.
―¿Lo has intentado? –le respondió el ave.
Y el edificio hizo intención y, piedra a piedra, se elevó por el cielo.
El chico salió de la biblioteca del barrio con un montón de libros bajo el brazo.
―¡Mira, papá, los voy a leer todos este verano!
El padre sonrió y le dijo:
―Muy bien, hijo, pero no se trata de engullir libros, sino de rumiarlos y digerirlos.
Igual a ellos. No acabo de comprender a las personas. Llevan décadas intentando construir un robot que sea igual a ellos y, ahora que ya lo han conseguido, me meten en la cárcel acusado de asesinato; pues… ¿qué pensaban que iban a construir?

Mes 7.

Tras la lucha encarnizada en los confines del universo la resistencia venció a las hordas del pérfido emperador Queak. El último acto fue localizar el acorazado imperial y devolver todos los libros a sus bibliotecas; sólo entonces brindaron entre gritos y alegría. Tenía ojos de pantera, andaba con movimientos felinos entre las mesas del restaurante; los comensales no la quitaban los ojos de encima. En la calle, la noche. El silencio. Al girar una callejuela la mujer pantera se transformó: se había quedado con hambre. Se levantó de la cama, la luna llena; se acercó como hipnotizada a la terraza; las cortinas cerradas, las puertas abiertas. Desde fuera un hombre aguarda y sonríe mostrando sus colmillos. «Permíteme entrar», a la joven le pareció escuchar.
Tic…tac. Tic…tac…
—Ya queda poco.
Tic…Tac…
—¡Ahora!
Y, coincidiendo con el primer ¡ding! del reloj de la plaza anunciando el fin de año, los ladrones activaron el conmutador, y la explosión abrió la caja fuerte del banco. Huyeron entre la gente. En aquel planeta existen dragones, sí de esos. Al llegar nos recibió, amenazante, un tipo extraño, a lomos de uno de ellos; dijo llamarse Quijenco, o algo así, y, al ver nuestra nave, nos creyó gigantes. Luego nos enteramos de que se había vuelto loco de tanto leer. Tras un largo viaje llegamos al planeta. Era el adecuado. Tenía agua y oxígeno y no hacía ni mucho frío ni calor. Sin embargo sólo esperábamos encontrar pequeños roedores o algo así. Ni se nos pasó por la cabeza que hubiera dragones… que hablaran. Era de esos que se han leído todos los libros que analizan, examinan y estudian pormenorizadamente una novela, pero que no se han leído esa novela. Paseando por entre las estanterías, acariciaba levemente con el dedo el canto de los libros; sabía que el que buscaba estaba allí, aunque no sabía cuál era. No importaba, notaría una leve descarga de magia cuando lo tocara.
Cuentan que al pueblo llegó un día un anciano con un elefante que jugaba al go; sí, ese juego de Japón. Todas las mañanas se ponían en una esquina de la plaza y jugaban.
―¿Cómo es eso? –le cuestionaban.
―Es que es muy listo –alegaba el anciano.
Llovía, las calles abarrotadas de gente que corría para no mojarse. En una esquina, un mendigo imploraba una ayuda para cenar. Nadie le hacía caso. En eso un niño se le acercó y le ofreció algo de beber: un poco de aceite para no oxidarse; el robot se lo agradeció.
Al leer el Quijote. Al leer el Quijote pregúntate cómo lo ve el propio don Quijote. Él se sabe caballero andante, y en las tierras que recorre a caballo habitan sabios nigromantes, dragones, demonios, todo tipo de hadas y duendes, rústicos dioses y toda índole de criaturas mágicas de los bosques; allí toda posada es un castillo, todo molino un gigante; a su alrededor él sólo ve damas a las que favorecer y caballeros andantes contra los que luchar –aparte de sus criados y los escuderos, como Sancho Panza–; su único objetivo: deshacer agravios, enderezar tuertos, enmendar sinrazones, satisfacer deudas, y de nada –o de todo, según se mire– se sorprende pues él todo lo atribuye a quimeras de la andante caballería. Por eso, imagina lo que él ve, cómo lo ve, incluso en lo referente a las ropas, pues a sus ojos no usan ropas de su época, no, sino que visten según modas medievales aunque con un evidente toque exótico, fruto de la insondable imaginación de don Quijote: por eso, al leer cada pasaje, observa los bellos vestidos de las damas, las armaduras y ropajes que usan sus adversarios de armas y que sólo don Quijote ve. Por eso, lo importante, por ejemplo, no es que sea Dorotea o no, lo importante es que sea la reina Micomicona. Eso te trasportará a otro mundo, al del Caballero de la Triste Figura; y ya verás, será genial. La vieja ciudad amurallada mantenía intacta su hegemonía en la región. Los altos muros seguían en pie tras milenios. Allí, en lo alto de la torre, el mago observaba. En eso dio un silbido y el dragón surgió en el horizonte; era la hora de sobrevolar la ciudad. El caballero galopa a lomos de su brioso corcel recorriendo la costa. Dicen que su enemigo ha sido avistado por aquella zona. En eso tiembla la tierra y del mar surge el gigante. El caballero, espada en ristre, va a por él, mientras recita el conjuro empequeñecedor. Las tres brujas controlaban el destino de las criaturas con naturalidad, claro, ¡tras toda una vida… ya dominaban los secretos de la vida! Bueno, hasta que Aquél creó a la humanidad; desde entonces ¡no hay manera!… el libre albedrío siempre se les escapa.
Cuando el caballero andante vio al gigante no lo dudó un instante y lanza en ristre arremetió contra él… ¡todo por su amada, la más fermosa doncella que verán los siglos! Cuando el piloto de la nave extraterrestre le vio llegar sólo tuvo que disparar una vez. El valle, las espigas altas y algunas vacas. A lo lejos un castillo. No es como los demás ni mucho menos. Dicen que, en realidad, es una nave espacial que llegó allí hace milenios. Sólo su dueño, un anciano al que todos aprecian, sabe que la leyenda es cierta. Tras la jornada laboral, la joven piloto del turbo reactor antigravitatorio descansa leyendo literatura clásica de anticipación; sí, ya sabes, aquellas novelas que trataban de vuelos interplanetarios escritas cuando aún no habíamos ni llegado a Marte por primera vez. Recuerdo que el primer robot que construí fue una cafetera aérea, con su motor antigravitatorio y su cerebro cuántico inteligente de quinta generación. Era genial; y hacía el mejor café que he tomado en mi vida. Y además educado. Lo tenía todo. Tiene una tienda de libros en una callejuela de la ciudad. Ya es anciano y su cabeza comienza a flaquear, por eso en un cajón guarda su diario donde ha escrito toda su vida, sus viajes a otros mundos, sus batallas contra alienígenas; pues ya todo lo empezó a olvidar. Sentado a los pies de una estatua en bronce de un elefante de grandes colmillos, observando a dos gatos jugando con un ovillo de lana azul, hago malabarismos con tres pelotas de plástico; a lo lejos el rugido de un dragón. Quizá sueño, quizá no. Amanece, en el cielo gritan potentes unos estorninos; desayuno leche con magdalenas; bajo la sombra de un árbol con don Quijote; en el teatro versionan Frankenstein, eso mañana; esta noche, el lago de los cisnes. «¡Matar humanos!», exclamó el robot. Media hora después, al revisar su biolog, el director del departamento de mantenimiento de la fábrica de robots decidió desconectarlo. Apareció a la deriva, un acorazado del ejército, sin tripulación, roto por la mitad, con un bocado que dejaba al aire toda la bodega. Los medios oficiales lo achacaron a los efectos de la tormenta. Nadie mencionó el monstruo que transportaban. Cuando vinimos a este planeta lamenté no poder traerme a mi mascota, un precioso setter irlandés, sin embargo ahora he conseguido tener una mascota autóctona; todas las tardes juego con él y le tiro la pelota y él la trae. Es un precioso dragón. La nave extraterrestre llegó y, levitando, se mantuvo sobre la gran pirámide. En eso ésta se desplegó como un puzzle tridimensional y, de aquella cámara secreta que nadie conocía, surgió el faraón. «Ya pensaba que no vendríais», les dijo. El explorador llegó al planeta con la misión de buscar vida, mas cuando localizó aquellos gigantescos seres autóctonos sintió miedo y se escondió bajo unas rocas. «¡Hombre, un nuevo espécimen de salamandra!», dijo el biólogo cuando lo encontró bajo esa piedra. En la torre, sus largos cabellos ofrecía aguardando al valeroso caballero que, demostrando su valía, llegara hasta ella, pues valor había que tener, y mucho, para escalar entre la tupida melena de Medusa camuflada. Allí, encerrada, en lo más alto de la más alta torre; sólo la muerte subió por sus largos cabellos rubios; a nadie más quería ella, a nadie más esperaba. El sol oculto, la arena fría, los pies descalzos, el alma rota, los pies mojados; los ojos rojos de tanto llorar. El cielo gris, las olas bravas; las huellas marcan el sendero seguido, a lo lejos una estrella fugaz; mientras, la marea trae recuerdos indeseados. Y cuando los humanos descubrieron a los marcianos en los mares subglaciares del casquete sur de Marte, éstos se hartaron de tener que esconderse siempre de aquéllos y decidieron atacar a la Tierra con todo su arsenal cuántico de última generación. Porque una cosa es la evolución del lenguaje y otra muy distinta la imposición de una «neolengua»; ¿recordáis «1984»? En ocasiones, tras ir a trabajar a la ciudad, sentía morriña de su casa en el mar; en esos momentos se sumergía en la bañera y chateaba con su familia, que allá, desde el profundo mar le contaban chistes y la hacían reír; y así la joven sirenita se animaba. Cuando se aburría, saltaba de viñeta.
―Maestro, ¿existen los alienígenas?
―Sí, mírate al espejo; están en ti, están en mí, somos nosotros.
Aterrizamos una mañana nublada, nos acoplamos el exoesqueleto y salimos a explorar, con nuestras largas servopiernas nos camuflábamos entre los árboles; los encontramos al atardecer, aún desconocían el fuego. Emprendimos la marcha hasta la próxima revisión. Desde que conseguimos terraformar Marte el viaje de sólo dos horas entre la Tierra y el planeta rojo me permite disfrutar de unos días de vacaciones y olvidarme del agobiante tráfico terrestre; además la menor gravedad marciana es genial para practicar deporte. La mujer se desmayó sin previo aviso. La socorrieron dos robots. Diagnóstico de su fallecimiento: causas naturales. Las autoridades decretaron tres días de luto oficial en todo el planeta. Al fin y al cabo era la última humana que aún habitaba la Tierra. Los chicos habían pintado con tiza un avión en el suelo y, al ver llegar a alguien, simularon que jugaban al juego del avión, saltando sobre el dibujo. Cuando se hubo ido, el avión tomó volumen y, con los chicos dentro, despegó. Sólo se les oyó decir «¡abrakadabra!»

Mes 8.

Anoche tuve un sueño extraño; en mí nació una sensación aunque como en fotogramas desparramados, como en flashes, no sé. Recuerdo que aterricé, me acoplé el exoesqueleto y salí a explorar; con mis largas servopiernas me camuflaba entre los árboles; los encontré al atardecer, aún desconocían el fuego, ¡humanos! Luego emprendí la marcha a mi planeta hasta la próxima revisión terráquea. Y es que, antes, había estado leyendo ciencia-ficción en la cama y, al dormir, aquellas páginas violentaron mi mente, o algo así. Todo el planeta era un desierto de fina arena y lo creímos deshabitado, pero cuando llegamos fuimos atacados por seres de grandes mandíbulas. Sí, a pesar de su aspecto desértico en él habitaban extrañas criaturas: tiburones subterráneos; la evolución, supongo. El sol en todo lo alto. El desierto desierto. En la cueva de la rocosa loma una mujer observa. La espada en ristre, la coraza de cuero, las botas altas; el pelo recogido, los ojos de acero. «Bien, este es el lugar», se dice; entra en la cueva y se teletransporta. En una cabaña en las montañas, tras un ajetreado día de exploración; refrescándose, con el agua hasta las rodillas, en un recoleto río. Mira el reloj. «Ya es la hora», se dice; y la joven sale del agua, se calza las botas, levita hasta la nave y vuela a hiperluz. En ese planeta hay montañas flotantes, por sus campos magnéticos, o algo así. Sus habitantes usan grandes telas y turbohélices y construyen megabarcos de piedra con los que recorren el planeta. Yo capitaneo uno; si los ves huye de ellos, somos piratas sanguinarios. La conocí justo antes de que yo huyera de los suyos, cuando nos invadieron; procedían del espacio, de un planeta acuático. Durante todo este tiempo han aguaformado la Tierra, pero finalmente regresé, y, después de tanto tiempo, nos encontramos en el ancho océano azul. Sobrevolamos el planeta. Fueron tres años de viaje y, por fin, llegamos. Desde la nave parecía deshabitado, aunque sabíamos que existían algunos depredadores y los grandes bosques… y esos profundos cráteres, claro; allí vivían los subterráneos. Fue una guerra atroz. En el planeta no hay nubes, no, esas nubes que se ven por todo el cielo no son nubes, ¡qué va!, son pulpos blancos gigantes. Os lo aseguro, ni se os ocurra hacerles rabiar, sobre todo si están dormidos… ¡tienen un despertar!… de verdad: ¡ríete de la bomba atómica! En las tierras del norte, más allá de las aguas heladas, tras la cordillera de nieves perpetuas un pueblo antiguo, más que todo recuerdo existente, construyó un muro infranqueable, donde, desde entonces, habita en silencio; eternos pobladores de inmortal porvenir. Apoyado en el alféizar de mi ventana, sentado sobre el pequeño tejado de tejas que cubre el ventanal del salón del piso de abajo, observo las aves que sobrevuelan majestuosas la porción del cielo que me rodea; junto a mí mis tres gatos: Musi, Lucy y Pontiac.
Por un camino solitario. En ocasiones voy paseando por un sendero solitario, sin nadie que me acompañe ni nadie que yo pueda ver, es decir, completamente solo, y en eso el camino cobra vida, se eleva, se eleva, se eleva y yo camino por él, y llego al cielo y más allá, como si andara sobre una serpiente gigante y llego a otro mundo; luego, tras un tiempo en él, regreso a mi barrio, y el camino vuelve a ser el mismo camino de siempre, a ras de tierra, y regreso a casa. Cuando ocurre esto nadie me ve, pues siempre me sucede cuando voy solo, sin nadie que me acompañe. Por eso no se lo he contado a nadie aún; nadie lo entendería, sólo yo lo comprendo. Aquella pradera estaba alfombrada de flores azules entre los hilos verdes de las plantas, y en el cielo azul las aves sobrevolaban la pradera. Visto con perspectiva parecía el mar, y las colinas, las olas bravateadas; recostado sobre ellas imaginaba nadar. Llegó a la aldea una mañana de abril, dijo llamarse Darir y ser herrero. Vino a caballo y era alto, y muy corpulento; dijo proceder del norte. Lo extraño era quién le acompañaba, porque le acompañaba un enorme oso blanco de tres metro de alto cuando se ponía de pie. Vivía en una apartada cabaña, en lo más profundo del bosque. Sólo había un inconveniente: en verano invadían los trolls; hasta que descubrió un divertido entretenimiento: tanto que la bruja, por mucho que lo intentara, no podía dejar de convertirlos en piedra. ¿Ves aquella montaña?, sí, aquella alta y rocosa… sí, fue toda una experiencia. En tiempos fueron gigantes con los que acabé luchando, aunque en un principio tuve como amigos; mas finalmente, por mucho que lo intentara, no podía dejar de convertirlos en piedra. «¡No podía, no, no podía dejar de convertirlos en piedra… en piedra!», gritaba desesperado el loco de la celda seis; ningún doctor se atrevía a acercarse a él, incluso con su camisa de fuerza. «¡No, por mucho que lo intentara, no podía dejar de convertirlos en piedra!» Llegó mi hora y reté a la Muerte a jugar una partida de ajedrez. «Si te gano me dejarás vivir», le reté; y cumplió su palabra. A la Muerte le gusta apostar. «¿Le ganaste?, ¿cómo fue posible?» «Contra lo que la gente suele pensar, la Muerte no sabe jugar al ajedrez». Según aumentaba la población, se elevaban los rascacielos más allá de las nubes, se hundían los edificios más allá del subsuelo; las autoridades, como ratas ante el naufragio, ya habían huido a otro planeta. Seis cosas imposibles antes del desayuno: Respirar bajo el agua (sin bombona de O2). / Volar. / Viajar al pasado. / Regresar de él. / Tener un dragón como mascota. / Volar a lomos suyos. De vez en cuando la tierra temblaba y la ciudad se elevaba y descendía con un movimiento rítmico pero brusco; la gente ya empezaba a estar algo cansada de tener que volver a cantarle nanas al gigante que hibernaba en el subsuelo. Acción del acordeón, adicción, quizá admiración que alegró el anís del avión. El bebé lloró, el señor del último sillón bebió café que sacó del cajón, mas no caminará pues se caerá sin remisión. Me desperté y resoplé; ¿soñé?, sí, soñé, ¡qué ilusión! Entre ruinas, a solas, una librería medio derruida; los libros que quedan sucios, carcomidos por el tiempo y las termitas. Ha llovido. El agua se cuela por los agujeros del techo. En medio, entre las estanterías, está creciendo un arbolito. En unos años dará libros.
Un petirrojo, en una rama, observa a lo lejos, buscando comida; un cigarra, de sopetón, salta y se posa en la espalda del pajarillo; alguien viene volando y grita, «¡quieto, no te muevas!», al petirrojo. Éste se gira y ve al hada que le ofrece, de menú, la cigarra. Tras el último terremoto el mar se desbordó. Yo vivía en un pequeño pueblo costero; me gustaba sentarme junto al andén de la estación y ver venir los trenes, escuchar sus sirenas y ver el humo saliendo por sus chimeneas –sí, eran de los de vapor–. Ahora el agua ha subido un metro hasta tierra adentro y yo me siento en el borde del andén y disfruto viendo llegar los tiburones a la estación. El extraño meteorito provocó un cráter de dimensiones ciclópeas. Nadie comprendía por qué aquella organización insignificante construyó su sede en el mismísimo vórtice; sólo cuando su campo electro-magnético-temporal convirtió a sus miembros en superhéroes. El futuro tendrá sus inconvenientes, no lo niego, pero ver cómo un espectacular galeón del siglo XVII levita entre las calles de la ciudad, en pleno siglo XXX, impulsado por la recientemente inventada matriz antigravitatoria, impresiona, te lo aseguro. ¿Cómo poder resistir las lágrimas prisioneras? No se puede, sólo déjalas salir, déjalas que corran y se aireen, si no se te aferrarán y no te soltarán; no te soltarán nunca, nunca jamás. Hazme caso. Yo le creé, fue obra mía, pero descubrí que no era lo que pretendía crear, por eso le tuve que matar, no tuve otra opción. Era mi criatura, pero no podía ser un Frankenstein; de verdad llegué a pensar que estaba muerto, pero aquello solo supuso un principio. El aire de ficción que respiraba le estaba matando, necesitaba salir, necesitaba germinar, vivir, ser: por eso primero logró convertirse en planta, luego en un niño; ya no podía soportar por más tiempo ser sólo un personaje secundario de aquel intrascendente libro. Llegué a la Tierra, dejé camuflada mi nave en un parque y pasé todo el día recorriendo la ciudad, observando a los humanos, intentando comprenderlos. Al atardecer regresé y vi a dos personas sentadas en un banco, ¡si supieran que están sentados en mi nave! Era una pequeña cabaña destartalada, medio derruida, pero cuando entraba en ella se convertía en lo que yo quisiera: en una nave espacial, en un galeón pirata, en un submarino, en un planeta interestelar; y para ello sólo necesitaba un libro.
Siempre la habían dicho que era especial, sus padres, sus amigos…, algunos en el colegio la llamaban bicho raro. Pero cuando detuvo la ofensiva alienígena creando un campo de fuerza alrededor de la Tierra, destruyendo los ataques kamikazes, todos se lo agradecieron. No estoy loco, sólo veo cosas que no existen; tengo ese poder, ¿qué quieres? Amanece. El sol brilla esplendoroso. Saco de la cuadra a Sultán, me monto en él y cabalgo al galope por el valle colindante; el viento me despeina. Desde que llegamos a este lejano planeta nada hay comparable a cabalgar a lomos de sus gusanos gigantes. En la exposición se reunieron antiguas armaduras de todo el mundo y de épocas distintas, los visitantes disfrutaban contemplando tanto esplendor; y eso que no asistían al duelo de ajedrez que se celebraba por la noche entre aquellos fantasmas guerreros. La ciudad está situada al borde del acantilado. Resulta sorprendente contemplar cómo se aproximan los cargueros dirigibles y galeones aerostáticos en busca de mercancías; los turboantigravitatorios fondean aparte. Es el principal centro comercial de todo el sector.

Mes 9.

El cielo gris, las casas de un color cemento-triste que tiraba de espaldas, la gente callada, cabizbaja… toda triste y gris. Se me ocurrió inventar una máquina para insuflar alegría en sus corazones; no tuve más remedio, y el verano tuvo que acabar lleno de colores. Lewis Carroll conocía la verdad, por eso escribió sus dos libros de Alicia contándolo todo, aunque lo hizo en clave, claro, utilizando el enrevesado algoritmo Brochowska-Reibnitz; de ahí su lenguaje intrincado, con su ilógica lógica. Me gusta salir a correr de noche, con luna llena a ser posible. Parecerá raro pero suelo atravesar el cementerio: se hace mucho ejercicio esquivando las garras de los zombies que intentan agarrarme desde sus fosas; y no te digo nada del hombre-lobo persiguiéndome. Una vez a la semana salgo de caza nocturna con mi katana. Tengo las paredes de mi casa llenas de cabezas, sólo las más espectaculares, claro, todas no me cabrían; las otras las vendo en el mercado negro. Mi preferida es la de un dragón del infernal submundo. ¿Qué me falta que sí tengan los demás gigantes para que don Quijote no se dignara luchar contra mí en desigual batalla?, ¿acaso no soy suficientemente grande, o harto malévolo?; ¿no he raptado a princesas?, ¿no he derribado montañas? ¡Exijo justicia! Cuando la humanidad llegó a aquel lejano planeta comprendió que era el lugar adecuado, casi tan bueno como lo era la Tierra; para algunos incluso mejor, pues su poca gravedad permitía que los transatlánticos volaran sin necesidad de ningún motor antigravitatorio. Se convirtió en el primer refugiado interestelar. En su lejano planeta de origen era un perseguido político y por eso llegó huyendo a la Tierra. A pesar de su aspecto de insecto tenía una portentosa voz de tenor y pronto se convirtió en toda una celebridad. En los siglos áureos el baile es vida, y, al caer la noche, la estrella del norte hace surgir la emoción en miradas seductoras y tímidos impulsos juveniles a escondidas, que evitan, entre risas y enredos apasionados, la mirada severa de la institutriz de turno. En la alegría de la intimidad pinto a lápiz en mi cuaderno preferido, me lo regaló un anciano vagabundo que conocí un día: pronunciando unas palabras secretas, todo lo que allí dibujo se hace realidad; hace tiempo que quería tener un dragón como mascota. En tiempos fue una fortaleza inaccesible: desde la base de la montaña, donde la primera muralla reprimía cualquier ataque, y continuaba a través de la empinada ladera, salpicada de torreones de vigilancia con amplios caserones para los soldados, hasta, en la cima, el imponente castillo del señor. Hoy, sin embargo, solo quedan algunos restos tras la gran guerra contra los dragones; esas bestias pueden con todo, no hay duda. Desde entonces los pocos humanos que quedamos sobrevivimos ocultos en la espesura de los bosques.
Cuando los alienígenas colonizaron la Tierra ya no había humanos en ella. Sólo encontraron ruinas, desechos enterrados bajo tierra, como si fueran restos arqueológicos. Incluso aquella nave, la última, que no pudo despegar. La guerra debió ser brutal, «holocáustica». Siempre me han gustado los felinos. Por eso, cuando en un viaje por Asia encontré abandonados a tres cachorros, me los lleve a mi casa en el campo. De eso hace ya unos siete años. Desde entonces nadie se atreve a atacarme ni a robar en mi casa. Los tigres imponen. Vivo tranquilo: observo el firmamento con mi antena multidireccional y controlo por si los cohetes y satélites que envían al espacio suponen alguna amenaza para los míos, allá, en el espacio profundo. Sí, desde que llegué a la Tierra, tengo una vida tranquila. Cuanto más me esfuerzo en pensar una idea para un relato menos me viene; me suele pasar, sin embargo, que se me acumulan si no las llamo. ¿Recuerdas cómo queda el cristal de una ventana cuando le cae la lluvia, todo colmado de gotitas, algunas de las cuales se escurren y caen, como si llorara? Pues así quedé yo cuando te vi marchar y lo perdí todo. Confianza. El cielo nublado, la playa desierta. Me quité las zapatillas y comencé a correr. Al llegar al acantilado me lancé al vacío. Justo antes de tocar el agua surgió imponente, planeando, y me elevó por el aire; sus garras acariciando el mar. Mi mascota: un dragón. Mientras en la playa los adultos perdían el tiempo poniendo sólo su atención en hablar por el móvil o escribiendo en la tablet, la pequeña niña disfrutaba del soleado día escuchando el suave murmullo de una caracola y chapoteando en la orilla.
Customizaron un viejo Chevrolet, lo convirtieron en un aeroplano a reacción y bombardearon sin miramientos la ciudad, principalmente los edificios gubernamentales. Los adultos, asombrados, huían de los dulces y caramelos que, inmisericordes, lanzaban los niños.
«Declaración Universal Stryntäld»: Datos biográficos: Nooll Stryntäld Sabelkin (32992 d.C. – 33085 d.C.): Vicepresidente del Alto Consejo Intergaláctico, principal promotor de la Declaración de Derechos y Obligaciones Universales, más conocida como Declaración Universal Stryntäld; Taiy (32960 d.C. – 33042 d.C.): Física especializada en partículas de alta densidad, madre de Nooll; Darird (32962 d.C. – 33063 d.C.): Ingeniero de robótica, diseño y fabricación de robots clase Diandên especializados en trabajos de alta precisión en las minas de Ushya, en el cinturón de asteroides Häld. Padre de Nooll.
Es imposible recoger toda la lluvia con las manos, sucede lo mismo que con los libros, que no se pueden leer todos; así que sólo abro los brazos y me dejo empapar con el agua que me cae encima. Los campos labrados en estricta rectitud, como un tablero indefinido aunque finito, en el que nos hubiera tocado en suerte competir a muerte o a vida de eterna resurrección. Todas las tardes el abuelo se reunía con sus nietos y les contaba las increíbles hazañas que hizo de joven, junto a su amo, allá por tierras lejanas, venciendo gigantes y salvando princesas; y de lo que más orgullos estaba era de su nombre: Rocinante. Aquel planeta parecía fácil de invadir, pensaron los alienígenas, sólo había que aniquilar a unos torpes bípedos; no se percataron de los verdaderos dueños del planeta: unos microbios letales. Por eso, al final, fueron derrotados; y así se salvó la Tierra.

Mes 10.

El espectáculo había ya empezado, pero aún faltaba lo mejor: La sentencia. Y la reina gritó: «¡Que le corten la cabeza!». «¡Menos mal!», se dijo aliviado el conejo blanco, que, como siempre, había llegado tarde; pero, se dijo: «más vale tarde…». En aquel planeta fueron los felinos los primeros en erguirse a dos patas, los primeros que consiguieron manos prensiles, los primeros en crear un lenguaje; luego llegó el meteorito y los homínidos fueron los únicos en sobrevivir.
Tengo cuentos que la gente ignora;
tengo, incluso, cuentos que se ocultan en mi olvido.
Aquella esquina del edificio, rota por el paso del tiempo, fue reconstruida con piezas de colores. Los duendes de ciudad que allí vivían lo celebraron sobremanera, pues lo preferían así; era mucho mejor que el color gris del antiguo cemento.
Como aleteos de una mariposa,
como latidos de mi corazón al verte,
surge, fluye, ríe;
alza los brazos, mira al cielo:
vibra el alma.
¿Quién dijo que don Quijote estaba loco?, ¿acaso el interesado Sancho?, ¿acaso los tontos duques?, ¿acaso los crueles que de él se burlaron?, ¿acaso la desdeñosa Altisidora? Nunca hubo nadie más libre, más genial, más cuerdo. Viví en una época en la que había que tener cuidado dónde pisabas; ibas caminando por la calle y, cuando menos te lo esperabas, un dragón enano te mordía los tobillos. Aún tengo cicatrices. Aunque peor era aún si te sobrevolaban y te escupían fuego, claro. La calle estaba atestada de coches. Buscar un taxi era tarea imposible a aquella hora, así que no lo pensé y me tiré desde la ventana de mi casa, en el sexagésimo quinto piso. Tres segundos después activé mi turbomochila y alcé el vuelo; no hay nada como volar.
―No te has muerto.
―Parece que no.
Una torre de aguja en el desierto hasta tocar la nada del cielo azul, ojos de gato, alas de ángel, corazón de ansia; y en un rincón de la librería espera paciente un libro con vida propia. Vivo en un barrio de callejuelas estrechas, ropas tendidas, tienduchas de menajes baratos, bares de platos precocinados y cervezas frías, pero cuando sobre los tejados bajos de tejas rotas sobrevuelan galeones aerostáticos los niños corren alegres y sueñan con volar.
―¿Qué lees?
―Literatura médica.
―¿Novelas o ensayos de divulgación científica?
―Supongo que podría llamarse divulgación científica, sí: leo los prospectos de las medicinas que tomo; ya sabes, con todos mis achaques no doy abasto…
El mes pasado descubrí un nuevo planeta con una extraordinaria fauna autóctona, en concreto sus hermosas mariposas. Ya he montado un negocio de vuelo libre.
―¿En ala delta?
―No, vuelo a lomos de sus mariposas gigantes.
Poción todolocura: Hígado de dragón envenenado con curare, 10,037 gr.; escamas de sirena inaod’m, 4,12 gr.; ojos de murciélago de la fruta de Egipto, 3,43 gr.; una rodaja fina de adolia; sangre de unicornio, 37,03 cl.; sopóforo seco, 3 gr.; y corteza de azarollo, sólo 1,07 gr.; macerar en lugar seco y cálido una semana. [*Poción para curar toda enfermedad. Medidas para una dosis. Las cantidades deben ser estrictamente exactas. La más mínima variación provoca la locura total. El que avisa no es traidor.] Misteriosa desaparición. CiudadClásica, 1887. Una tremenda explosión de luz de naturaleza desconocida tuvo lugar el pasado 20 de octubre a las 23:47h en el barrio residencial AuroraBoreal. A consecuencia de ella se constató la completa desaparición del antiguo palacete propiedad del excéntrico ingeniero y astrofísico don Esteban Hofftager Abráldez, así como del jardín circundante. Desgraciadamente también se ha verificado la desaparición del afamado científico, aunque la policía continúa rastreando la zona. Tras las primeras investigaciones se achaca el desgraciado suceso a una explosión de gas; no obstante, entre los escasos restos encontrados se han hallado extraños residuos que están siendo analizados por la policía científica. Seguiremos informando. [De nuestro enviado especial LJG]
―Dime algo romántico.
―Sin la mucosa gástrica, el estómago se digeriría a sí mismo.
En un lejano cuadrante estelar una luna se aproxima a un planeta; tras ella, una bandada de meteoritos. En el planeta se activa el cuadrilátero cúbico y una nave despega. En el cielo se abre el escudo. El campo de fuerza fluye protector. La explosión limpia el cielo. Por aquel entonces los coches levitaban entre los edificios, los toldos de colores sustituían el escudo de ozono del cielo, las plantas daban el oxígeno que faltaba en el aire, los dinosaurios de nueva generación eran las mascotas de moda; y todo por el progreso. Sé consciente de lo que tienes y no lo subestimes, pues hasta lo más sencillo del mundo requiere, no obstante, de todo un complejo entramado oculto bajo tus pies para hacerlo posible. Tic, tac, tic, tac, el tiempo avanza, lento, imparable, inexorable, ya se acerca el objetivo, ya la hora está próxima, pronto se cumplirá el sentido de mi vida, lento, lento, tic, tac, tic, tac. Me subí al tren, «¡qué extraño, todo vacío!», pensé, y se puso en marcha. Las puertas se cerraron, las ventanas herméticas, el tren salió de las vías y se sumergió en el mar; y por las ventanas vi acercarse ballenas cantando, delfines revoloteando, sirenas sonriendo.

Suave la aurora, dulce la miel,
vuela la alondra, canta el doncel;
nieve en la cumbre,
fuego en la lumbre;
risueña la dama,
que a todos ama.
Ah, y un petirrojo en la rama.

―¿Duermes con armadura?
―Es que no has visto cómo son los mosquitos por aquí.

Con la luna iluminando la noche
camino a solas, mas no perdido,
por la senda nocturna, solo;
busco sin tregua una guía eterna,
refugio de un destino ofrecido,
olvidado, anhelado, no obstante;
a solas, caminando por la senda nocturna.

He visto un gran dragón blanco bebiendo del río, allá arriba, en lo profundo del bosque, donde el monte oculta secretos. Decían que no existían y seguirán sin saber que existen, así es mejor, es la única manera de que sigan existiendo; sé guardar un secreto.

Amanece el cielo claro,
el sol por la ventana,
el desayuno en la mesa:
chocolate y miel calientes,
pan con nata, galletas de nueces y pasas;
entrando por la terraza trinos cercanos,
y el viento en las hojas, bailando.

Mes 11.

«Llamo a la puerta, nadie abre. No sé cómo pero me he perdido, menos mal que he encontrado esta cabaña junto a un manantial; sólo me queda un trozo del bocadillo y casi nada de agua. Es necesario que encuentre el camino de regreso. Relleno la cantimplora. “¿No hay nadie?”, grito. Nadie contesta. Parece abandonada. Desisto y me voy.» Hizo bien en no entrar. La bruja le observaba desde dentro y se relamía. Fahrenheit 451, la temperatura a la que arden los zombies en aquel planeta antes llamado Tierra. Paseando por el parque, el sol desafiante, me atravesó el cuerpo un rayo de luz; me teletransporté entre las estrellas, atravesé nebulosas, circunvalé planetas de vida inimaginable. Regresé a la Tierra con otra experiencia de mi existencia, ¿mejor?, sí, mejor, óptima. 1895. La joven pareja pasea por el solitario parque a orillas del lago. «¡Mira, Juan!», le dice ella, señalando al agua; y le empuja. Él cae, algo asciende de las profundidades y el agua hierve. «¡Mamá, no comas tan deprisa!», dice la joven sirena y se lanza al agua. Mis padres compraron un robot. Era un último modelo, clase Dream, eficaz y educado; era como un mayordomo pero positrónico. Sin embargo tuvimos que cambiarlo por otro; no sé por qué detestaba a uno de los electrodomésticos de casa y quería matar al despertador. Al año siguiente, cuando caían las flores del cerezo. Aproveché la hora libre entre clase y clase de robótica para leer un rato. Me senté junto a la ventana en un rincón apartado y silencioso, me puse las hologafas y el libro se virtualizó ante mi vista; ¡y pensar que antes los libros eran de papel!

Nada hay de lo que hay que sea. Sólo Dios.
Cosiendo árboles en un edredón,
cantando nanas en hojas verdes;
riendo soles al amanecer,
nadando entre nubes blancas;
haciendo sombras sobre libros viejos,
construyendo mundos con las manos.
Un lápiz, una flor, un trino suave,
estrellas que iluminan la noche.

Sentado en el suelo un anciano toca una música sutil con una flauta dulce frente a un hermoso mosaico. En eso interpreta una polifonía vertiginosa, repentina, y del suelo el ave fénix cobra vida y surge radiante. Alza el vuelo. Alcanza las nubes. El sol resplandece. Era una civilización tan avanzada que construían naves capaces de albergar la población de todo un planeta. Naves cilíndricas, de tamaño descomunal, las ciudades en su pared interna, incluyen mares internos. Se hacían llamar humanos. Lo más complicado siempre fue edificar las nuevas ciudades, por eso al final se decidió construir las naves estelares de forma que cuando aterrizaran en los planetas también sirvieran de edificios; sólo hacía falta «plantar» las naves. Cuando todo el cielo fue homérico, como si de un mar embravecido se tratara, las monstruosas nubes engulleron la ciudad y, tras su paso, todo fue nada. Dicen, los que sobrevivieron, que en los cúmulos se escuchaban bramidos; yo considero que eran demonios. Allí nos conocimos. Quién nos lo iba a decir, al fin y al cabo a nuestra edad…, pero allí nos enamoramos. Nuestros hijos nos consideraban un estorbo y nos habían metido en aquel geriátrico; pero había llegado nuestro momento, había llegado el día de fugarnos. De pequeño me encantaba «la fuga de Logan», tanto que un día metí mis juguetes en una maleta y, con mi amigo imaginario, nos fuimos. Sólo llegamos hasta el parque y regresamos para cenar, claro, pero teníamos que hacerlo, no en vano había llegado el día de fugarnos. Se dice que los gatos son de otro tiempo, ¡quía!, los gatos inventaron el tiempo.
―¿Decías?
―Que la mitología es a la literatura como los cimientos a los rascacielos.
Tardé casi un mes en construir mi propia nave espacial. La semana pasada la estrené y viajé a Marte; ¡si tengo que esperar a que llegue la NASA & Co. me muero antes de viejo! Viaje a Marte. Según una leyenda urbana de principios del siglo XX, fue un ingeniero español el primero en llegar a Marte. Yo no la creía, naturalmente, y eso que mi abuelo me dijo en una ocasión que era cierta. Por lo visto el rumor se extendió por todo el país y parte del extranjero, aunque la mayoría se lo tomaban a guasa. Sin embargo, en el curso de unas investigaciones que realicé para un proyecto que me encomendaron, encontré un anuncio en un periódico del 23 de octubre de 1887 que decía:

«SE BUSCA copiloto para viaje a Marte. Requisitos indispensables: licencia PPL o CPL y título en astrofísica. Se ofrece fama y honores. Telf.: 5555-32-13 – Ref.: 103592»

Ni que decir tiene que me quedé sin saber qué pensar. Desde entonces continúo buscando. Os seguiré informando sobre cualquier novedad. Anochece, las farolas iluminan el suelo recién mojado por la lluvia que ya no cae y forman espejos en el asfalto de las calles solitarias de peatones pero no de tranvías que, calle abajo calle arriba, van de la colina al puerto marítimo y regresan. El aire fresco. Entre los rascacielos infinitos, una humilde torre de apenas cuatro pisos; sus vecinos se defienden como gato panza arriba por conservar su preciosa panorámica del cielo; y en las noches claras salen a sus balcones y observan las estrellas y charlan de la vida. El puente colgante unía la ciudad con aquella isla boscosa. Los vecinos iban y venían cada día, todos excepto las noches de nieva baja y espesa, cuando el silencio nocturno se desquebrajaba con aquel lamento quejumbroso, pavoroso, monstruoso. La dama de elegante vestido blanco aguardaba la llegada del tranvía. Su sombrilla de encaje la cubría del sol. A su llegada subió al vagón, se sentó y el tranvía arrancó en silencio; su motor antigravitatorio le permitió ascender y transitar entre los edificios. Amanecía. El sol entraba por la ventana. Hanna se despertó y parpadeó. Miró tras el cristal de la ventana y contempló la ciudad: sus altos rascacielos, los tranvías levitando ingrávidos entre los edificios. La joven robot, un androide clase Love, amaba ver amanecer. ¿Un invento sorprendente?, la matriz antigravitatoria: instalada en coches, barcos, trenes, permite que el objeto vuele; las naves alcanzan en el espacio velocidades cuasilumínicas; instalada en edificios, permite que flotemos ingrávidos en las habitaciones. Cuando agotemos los recursos naturales de la Tierra, los buscaremos en los planetas del sistema Solar; cuando los agotemos, los buscaremos en los asteroides; cuando los agotemos también allí, moriremos. Valoremos lo que aún tenemos y no lo malgastemos. La niebla de otoño sonríe maliciosa, burlesca, como bufón hiperactivo, malicioso, burlesco; y, tras ella, nos aguardan seres asombrosos de un bosque sincrético, malicioso, burlesco. El salón de casa a media luz, para no deslumbrar fuera, y yo sentado tras los cristales, bebiendo una infusión y leyendo. Fuera pasean por delante de mi casa algunos peces y, a lo lejos, descansan dos ballenas; todo ello desde que las ciudades también son submarinas. Era un día lluvioso, el menos indicado para lo que sucedió. Ya comenzaba a atardecer y el sol tomaba color de noche temprana. Entonces el cielo se iluminó y ellos llegaron. Así fue el primer contacto con extraterrestres; aunque el día era lluvioso, inapropiado. No escribo para explicar, sino para sugerir. Por la noche los duendes primero van al salón, sigilosos, y cogen unos dedales del costurero, luego bajan a la bodega, abren una pizca el grifo del barril de cerveza y llenan los dedales; cuando al amanecer regresan a su casa bajo el suelo del piso van dando eses. Los duendes saben leer. En ocasiones suben por las estanterías de mi pequeña biblioteca casera y eligen alguno de mis libros. Creo que ahora están leyendo mi Persiles de Cervantes; y tienen la mala costumbre de doblar el pico de las hojas como marcapáginas. Cuando tienen que recorrer grandes distancias, los duendes de bajo mi casa viajan en gorrión, es mucho más rápido que cabalgando sobre liebre. En ocasiones hacen noche en algún nido, incluso le piden permiso a alguna ardilla para dormir en su madriguera de árbol. En ocasiones los duendes que viven bajo el suelo de mi casa celebran torneos nocturnos de arco y flechas con las agujas de coser que tengo en el costurero. De diana usan una manzana. Su rey cabalga en un gran sapo verde o sobre un ratón pelirrojo. En una ocasión le pregunté a uno de los duendes que viven bajo mi casa cuál era el secreto de su longevidad.
―¿Secreto?, no, no hay ningún secreto: vida sana, comida fresca, ejercicio, pero sin excederse, y un vaso de savia para desayunar.
―Pero, señor juez, no sé cómo pasó: estábamos delante de la pastelería relamiéndonos viendo los pasteles y dulces cuando una señora mayor nos vio, «¡perritos guapos!», nos dijo, y entonces dijo el conjuro y nos convertimos en personas; por eso nos pillaron desnudos. Zoo. ¿Nunca has deseado algo imposible? Yo sí. Verás, tengo un zoo, pero no uno normal, ¡qué va!, ni mucho menos. Yo tengo colibríes con cabeza de lobo siberiano, los colores tornasolados; pájaros de plumaje blanco y negro y cabeza de orca; osos pardo con cabeza de paloma mensajera, blanco-nata; gaviotas con cabeza de conejo, las orejas largas; patos blancos con cuello y cabeza de serpiente pitón; lechuzas con cabeza de gato; hámsteres con cabeza de hipopótamo, la enorme boca abierta; búhos blancos con cabeza de tigre; caracoles con cabeza de hipopótamo, la concha color madera; pajarillos de vivos colores y cabeza de mandril de grandes colmillos; periquitos-tigre, feroces; elefantes con cabeza de mariposa de vivos colores; gorilas con cabeza de toro bravo, desafiantes, andando a dos patas; cebras con alas posándose sobre una flor; tortugas con cabeza de jirafa; rinocerontes con la piel del color de una cebra; un par de erizos, uno con cara de gato y el otro diente de león; pingüinos-orca; koalas de cabeza de elefante; unicornios; pollitos con cabeza de serpiente; dragones, al cual más espectacular; ciervos de gran cornamenta, grandes como un oso polar; esos animales que todos hemos querido tener alguna vez. SE BUSCA genetista con ganas de indagar. El viaje duró tres años pero valió la pena, verdaderamente: un planeta casi idéntico a la Tierra, al otro extremo de la galaxia, con ríos de agua potable, animales, flora y oxigeno; lo más extraordinario fue, no obstante, encontrar pirámides como las de Egipto. Aquel planeta estuvo habitado, hace milenios, pero lo estuvo, no cabía duda. Los astronautas encontraron ruinas de antiguos edificios, incluso inscripciones en sus paredes. Lo asombroso fue cuando los expertos aseguraron que se trataba de sumerio. Cuando no se me ocurre un argumento adecuado para un cuento, satisfago mis ansias de escribir buscando imágenes aleatorias sobre un tema en concreto o sobre muchos a la vez y escribo sobre lo que veo, sencillamente. Es entonces cuando, sin quererlo, me vienen a la mente leyendas. En ocasiones escribir es como montar un mecano: basta con colocar unas piezas sobre otras, incluso al azar. Cuando has terminado lo miras con perspectiva y el objeto que has construido siempre es algo intrincado que se parece a algo sumamente interesante, o viceversa. Me hice una foto con mis dos amigos. Íbamos a la misma clase en el colegio. Se llamaban Juan y Ladislao y éramos muy buenos amigos. Sentí mucho cuando me enteré que habían muerto de viejos. Por cierto, yo soy el del medio de la foto; soy un robot clase Joy. Una tormenta recorre el cielo, ruge, rasga el aire electrificado, mientras chisporrotean rayos que hieren la tierra y hacen retumbar hasta las entrañas del mismo planeta; caudal inagotable que inunda la superficie y se filtra por las rendijas que crean ríos. Se quedó mirando amanecer por la ventana mientras bebía una taza de té. «Hermoso el sol que surge», se dijo, y se miró la mano. «Curioso que lo diga yo», pensó; al fin y al cabo sólo era un robot, o quizá ya no. Este planeta es asombroso: sus campos magnéticos le dan un algo inigualable, aún no he conseguido acostumbrarme. Simplemente me siento y coloco una piedra delante de mí y me puedo pasar el día entero mirando como levita a un palmo del suelo. Sólo soy un simple astrónomo aficionado que una noche miraba el cielo buscando estrellas fugaces, y entonces los vi llegar en su nave de otro mundo. Yo los vi primero, antes que nadie, por eso quisieron hablar conmigo antes que con nadie; «cortesía obliga», dijeron. Todo el planeta era un solo mar, excepto una isla solitaria en la que las ruinas de un antiguo edificio de estilo griego clásico mantenía vivo el recuerdo de sus ya extintos moradores. La ventana cerrada, los visillos echados; la joven ama de llaves observa el paisaje. Mira al jardín y recuerda cuando sacaba a pasear a los hijos de los señores. Eso fue hace ya muchos años, cuando era joven, cuando el incendio en el que murió. Al calor de la chimenea el abuelo contaba historias de miedo a sus nietos. Éstos le escuchaban en silencio, reían las voces y gestos que ponía y las sombras que hacían sus manos en la pared. El abuelo sin embargo las contaba con respeto; aún le daban miedo. Recorría los planetas con su carguero espacial vendiendo de todo: desde juguetes para los niños hasta monstruosas babosas asesinas Saseks, de infinitos dientes punzantes y tentáculos como látigos repletos de afilados garfios emponzoñados, para las peleas ilegales. Año 3655 d.C. Cuando un robot se queda obsoleto lo tiran al basurero. Yo los recojo y adecento, pues, salvo pequeños ajustes, aún están operativos; no serán de la última generación pero aún funcionan bien. No acabo de entender por qué se deshacen de ellos. ¡Superhéroes!, ser superhéroe está sobrevalorado, con superpoderes cualquiera es capaz de hacer lo que ellos hacen; ¡a ver si ellos son capaces de llegar a fin de mes con toda mi familia y sólo mi sueldo!
«Siempre» es un lugar.

Siempre al atardecer, cuando el sol se oculta
y el sonido del mar reverbera
y el viento de poniente levanta bruma,
fíjate bien a lo lejos y verás
a las sirenas saltar entre las olas.

Siempre entraba en la biblioteca a escondidas, cogía un libro y me escabullía en un rincón; allí, bajo una mesa, lo abría y comenzaba a leerlo. Cuando levantaba la vista siempre estaba en otro planeta.
―¡Padre, yo no quise, pero no tuve otra opción! Me diste entrada en esta dimensión de horror; me sacaste de la nada pero a costa de encerrarme en la sombra. ¡Dr. Frankenstein, padre, perdóname! –gritaba el monstruo acusado de parricidio, mientras huía por el Ártico.
El sol hunde sus rayos en el lago, las ninfas ríen, juegan con el agua; en una rama un hada conversa con una ardilla, ésta le ofrece una nuez; en una roca junto a la cascada alguien escribió hace mucho unos pictogramas, una náyade lo lee y ríe; cosas del bosque.
Dos robots:
―Me duele la cabeza.
―Te faltará un tornillo.
Cuentan que un robot se desajustó un tornillo y se sobrecalentó un chip neuronal aplicándose un algoritmo de aleatoriedad máxima.
―¿Voluntariamente? ¿Por qué?
―Dijo que envidiaba a los humanos y quería saber lo que era la emoción.
Llegué a Marte, oculté mi nave tras unos montículos, la cubrí con una lona de camuflaje y me puse a esperarles. «¡La sorpresa que se van a llevar esos de la NASA & Co. cuando vean que he llegado antes que ellos!», me dije sin poder disimular una sonrisa. La reina del bosque es una niña de cabellos largos y rubios, que viste una larga túnica blanca y va descalza. Los animales la respetan, inclusive el oso pardo y el lobo gris. Por la noche la reina recorre cada rincón y sana cada árbol herido y cada flor maltrecha. Cuando al amanecer baja la niebla y oculta el bosque de las miradas indiscretas, la reina del bosque le cuenta cuentos a las rocas que, disimuladamente, sonríen son su suave voz profunda; al eco también le gustan esos cuentos y también ríe.

Mes 12.

En ocasiones me abruma la perfección, otras la desprecio por insuficiente; sólo busco la santidad.
―¿Cómo os conocisteis, abuelo?
―Anochecía. Yo estaba viendo la tele y ella llamó por la ventana; me quedé impresionado. Su aspecto, su extraña nave espacial… Dijo venir de un lejano planeta. Me pidió ayuda. Aquella noche a tu abuela y a mí se nos quedó corto el café.
―Esta noche viajaremos aquí –dijo señalando el mapa.
―Pero, eso es la Tierra y está llena de humanos.
―Sí, lo sé, pero es más barato que ir al circo y hacen más tonterías.
―Me duele el alma.
―Tú no tienes alma.
Y el robot se fue a su rincón y lloró.
―Ya sólo te tengo a ti –le dijo el robot a su osito de peluche mientras esperaban el autobús nocturno para irse de la ciudad.
Con los nuevos avances tecnobiológicos promovidos por el nuevo gobierno, la ciudad se llenó de carteles del tipo: Peligro de transmogrificación. Prohibido jugar con la materia oscura. Atención, riesgo de crionización. Paso a un universo paralelo. Desde que terraformamos Marte el planeta se ha atiborrado de turistas. Esto se empieza a parecer a la Tierra. Echo de menos la época en la que sólo lo visitaban los astronautas y las sondas robotizadas.
―Con los trenes ultrarrápidos de ahora se puede dar la vuelta al mundo entero en quince minutos.
―Sí, echo de menos los viajes de tres horas de antes; en éstos ya no se tiene tiempo ni para leer.
―¿Qué sientes, Rob?
―Yo no siento, señor –respondió el robot.
―En ocasiones te envidio, la verdad –le respondió el humano.
El joven araba la tierra lentamente con su tractor.
―Date prisa, hijo; tenemos que terminar hoy –le dijo su padre.
―Ya voy padre, estaba reviviendo los viejos tiempos –le respondió su hijo.
Y el tractor se transformó en un robot eficiente y ultrarrápido de arado.
Todo el día de un lado a otro, ya no podía más. Se detuvo, se apoyó en la barandilla y observo en silencio la ciudad bulliciosa. Un gato se le acercó, se encaramó al pasamanos y le observó en silencio.
―¿A ti te ocurre lo mismo? –le dijo el robot acariciándole.
Le habían ordenado que comprara 2kg de manzanas y kilo y cuarto de filetes de ternera clonada; cuando regresaba a casa, una mariposa le llamó la atención: revoloteaba entre unas flores silvestres junto a la autopista. Era la primera vez que el robot veía algo así. Cuestión de física aplicada. Cuentan que la velocidad final es igual a la velocidad inicial más la aceleración alcanzada multiplicada por el tiempo transcurrido entre ambos hitos, y que por eso morimos al caer desde lo alto (Vf = Vi + a.t), pero no es cierto, no, morimos porque nos estrellamos al someternos a una fuerza de magnitud equivalente a multiplicar nuestra masa por la aceleración que alcanzamos al tocar el suelo (F = m.a).
―Cuentan que la mutación habló.
―¿Y qué dijo?
―Pues dijo: «Ahora vamos por aquí, ¿vale?…CCCTGTGGAGCCACACCCTAGGCCAATC… ¿y si probamos ahora esto otro?…»
No usaba reloj, sólo una brújula.
Llegué a casa y en las perchas había colgados seis abrigos largos, negros, seis sombreros puntiagudos de alas anchas, seis escobas y seis gatos negros sobre la repisa. «¡Ah, sí, que hoy tienen reunión del club», me dije, y me fui al bar sin que me viera mi esposa. Hay paisajes que sólo se disfrutan de cerca. A veces escribo varias ideas sueltas sobre diversas cosas (algunas increíbles, otras no) y sin relación alguna entre ellas, luego trato de escribir un #cuento/#microcuento con todas ellas juntas. En ocasiones hasta yo mismo me sorprendo (gratamente) del resultado.
―Yo no sé dónde está el tesoro –dijo John Silver el Largo.
En eso le comenzó a crecer su pierna de palo; al parecer ella y Pinocho compartían las mismas raíces.
―Eres un minimalista.
―Ya sabes que lo bueno si breve dos veces bueno, pues eso.
Sentados en el malecón algunos pescadores, aquel día no parecía propicio para pescar anda. En eso por la rampa de las embarcaciones salió del agua un buzo arrastrando al kraken.
―Ya estaba harto de que se comiera toda la pesca –dijo el buzo.
En aquel mundo acuático las grandes bestias amaestradas, grandes como dos ballenas juntas y con las bolsas guturales transparente, eran los mejores batiscafos turísticos que uno podía imaginar. Sentado sobre una roca comenzó a llover, miró al cielo y, a su pesar, abrió su pequeño paraguas. Al gigante de piedra le gustaba la lluvia pero no soportaba el musgo que se formaba en los huecos de sus articulaciones; ya era viejo y su artrosis iba a más. El pequeño fox terrier iba paseando, con la lengua afuera, alegre; nadie le llevaba aunque tenía puesto la correa, y ésta levitaba tras él. Era la única manera que tenía el monstruo del bosque de pasear a su mascota, si no los humanos del pueblo le verían. La niña chapoteaba en la orilla del mar, levantó su báculo con ambas manos y susurró algo indescifrable. En eso la pequeña ola se convirtió en una ninfa de agua transparente. La niña rió y ambas se pusieron a jugar. Eso era mucho mejor que tener una amiga imaginaria. Por la noche, cuando todos dormían y sólo los búhos ululaban, aquella carretera de tercera desenterraba sus raíces de asfalto y alzaba el vuelo. Cuando nadie mira, al atardecer, cuando el sol se oculta y el campo descansa, el espantapájaros se desclava del suelo cultivado y vuela en su escoba hasta el terruño vecino, donde crece trigo y vive su ahuyentaves amada. La niña iba por la calle y sujetaba alegre las cuerdas de sus globos que volaban sobre su cabeza. Imaginaban ser extraños seres de vivos colores, pero eran en verdad los fantasmas de los muertos de su casa, aquella mansión donde sucedieron aquellos crímenes horrendos. El hada revolotea entre flores, en eso comienza a granizar y ella mira al cielo descontenta; el hielo puede lesionarla y estropear sus alas. En eso una gran roca cobra vida y, alzando un pequeño paraguas, protege a la ninfa. Ella, agradecida, le besa en la calva.
La bruja se aparece en la parada del autobús.
―¿El de las 14:35?
―Llega con retraso –le contesta el espíritu del bosque que también espera.
―¡Como siga así pondré una queja al Ministerio Mágico de Conjuros de Teletransportación!
Ahuyentaves*: (En ciertas comarcas del norte también ahuyetaves). Dícese de los espantapájaros-mujeres. Al igual que sus compañeros hombres son seres mágicos de inmenso poder que protegen los campos y cualquier territorio que así lo precise de los enemigos del bien y de la paz. En épocas muy remotas, ya olvidadas, hicieron un pacto con la humanidad para proteger nuestros campos cultivados. Se desconoce el motivo aunque, según leyendas, lo hicieron para recompensarnos por la ayuda que les ofrecimos en una antigua guerra contra los titanes. Actualmente, sin embargo, permanecen inmóviles como simples muñecos, de paja preferentemente, pues los humanos rompimos el pacto cuando, entre otras cosas, decidimos destruir indiscriminadamente bosques y selvas, de modo que los espantapájaros nos sometieron a un conjuro de olvido, y por eso ahora los consideramos simples muñecos inanimados. No obstante aguardan pacientes que rectifiquemos para volver a la vida activa. (*De la Enciclopedia de lo Antiguo.)
En la noche oscura, los zorros juegan con los fuegos fatuos; las luciérnagas les tienen envidia, pues se aburren solas.
Apasabullando*: En épocas legendarias, dícese de los gigantes de las tierras ignotas del norte en estado furioso, malhumorado, cabreado en grado sumo, que por donde pasaban todo lo destruían. Capaces de demoler montañas, normalmente atacaban con un gran martillo de hierro forjado, ancho, indestructible, rico en grabados de ascendencia mitológica y de mango de inalterable madera de quebracho colorado. Dicen que el sonido profundo del cuerno de balrog que hacían sonar cuando emprendían la embestida, y que siempre llevaban sujeto a la cintura, sonaba como el rugido de dragón. De ahí que actualmente aún se conserve este vocablo en algunos dialectos en las islas más septentrionales y se aplique para denominar a todo aquel individuo que pasa por cualquier lugar apabullando, sin dejar títere con cabeza. (*De la Enciclopedia de lo Antiguo.)
«Y los dioses descendieron del cielo y vivieron entre nosotros tres ciclos solares. Les agradecemos sus consejos.» –así tradujeron los lingüistas la tablilla maya encontrada en las ruinas de aquella ciudad perdida. En aquel sello del faraón, con el que firmaba los documentos oficiales, y tras intensos y profundos estudios lingüísticos, los expertos llegaron a la conclusión de que la traducción más exacta y fiel de aquel jeroglífico era: «Soy el puto amo, yo el faraón.» Amanecía. La joven despertó. Se levantó de la cama. El sol entraba por la ventana. A lo lejos se oyeron trinos. Se duchó, se peinó y se vistió. Eran las 08:33, y el robot de exquisita apariencia humana salió de casa. Hoy comenzaba a trabajar de neurocirujana. Un capricho. Estudié arquitectura y planifiqué edificios por todo el mundo. De todos ellos estoy orgulloso pero mi preferido fue uno especial: un rascacielos de curvas aerodinámicas y grandes ventanales panorámicos. Ese no lo vendí, me lo quedé para mí; fue un capricho. Un verano le acoplé un propulsor en los cimientos y me marché a viajar por el espacio. Es que yo siempre quise ser astronauta. Dijeron los expertos que el cielo se estaba quedando sin oxígeno. Me fui a una tienda, me compré todos los globos que pude, soplé, soplé y soplé, y los llené de aire, luego los dejé volar. Los vi ascender y perderse entre las nubes. Por mí que no quede. Los sensores indicaron que la radiactividad había bajado lo suficiente como para que el planeta volviera a ser habitable. Cuando salí vi que todo, hasta perderse por el horizonte, era desierto. «¡Yo os maldigo, os maldigo!», grité golpeando el suelo con los puños. La ciudad como mosaico, allá los rascacielos, cerca un parque con niños jugando; a través de una ventana se escucha una nana, la madre le canta a su hija; cuentan que en épocas no tan remotas un bosque circundaba la ciudad. Hoy los coches levitan sobre los edificios. Tras la guerra la ciudad quedó inundada, pero no se reconstruyó, ¿para qué?, así queda mejor; los edificios rotos y los canales le dan un aspecto más renacentista. Los turistas se imaginan estar en la Tierra aunque está a treinta años luz. Miro y veo un cuadro pero es un paisaje real: a lo lejos naranjasonrosado para el cielo, más abajo la sombra amarillenta de las montañas, luego los árboles violetas y morados, en el centro un lago azul oscuro, cerca un prado verdoso y caballos en la sombra. Atardece. Hay tanto que ver que no consigo hacerme una idea de conjunto, sólo los fragmentos centran mi mirada: aquí un escaparate, allí un toldo rojo haciendo esquina, calle abajo el mar, por el cielo pasa un automóvil sin ruedas; allá lejos los rascacielos. No hay pájaros. Aquel callejón parecía de lo más normal, pero en la primera puerta a la derecha había escrito algo en lengua encriptada extraña, algo imposible de leer salvo para los iniciados. Al leerlo se activaba el campo de modo que tras cada puerta se accedía a otros mundos. Es noche de luna llena. A la puerta de un palacete, a los pies de la escalera, una joven yace muerta. La policía estudia la escena del crimen. No hay pistas, sólo un mordisco en el cuello de la víctima. En eso, por la ventana se escabulle volando un murciélago. A la salida de la discoteca Drácula mordía a los jóvenes que regresaban a su casa. La policía no pudo detener al vampiro por asesinato, no tenían ninguna prueba contra él, pero le detuvieron por volar con exceso de alcohol en la sangre.
―Abuelita, ¿por qué me miras así?
―Te voy a contar un cuento: érase una vez un niño que se perdió en el bosque y lo recogió una bruja. Lo cuidó y lo alimentó y, cuando estaba bien gordito –como tú ahora–, se lo comió. Pues ese niño eres tú –le contestó la bruja.
El puerto espacial está repleto de gente, y entre ellos un padre despide a su hijo; es su primer viaje solo. Naturalmente el chico lleva un compensador de gravedad personal, si no no podrá soportar la mayor gravedad de la Tierra; y es que el joven ha nacido en Marte. El elegante navío de diseño renacentista zarpó del puerto, y, obedeciendo las órdenes del capitán, los marineros extendieron sus amplias velas y emprendieron el vuelo. Era una de las ventajas de aquel planeta recién colonizado: su baja gravedad. Sólo imagina que todo es verdad.

FIN

Luis J. Goróstegui [2018]

201. Los aldeanos.

Etiquetas

201. Los aldeanos.

El escalador, tras una semana de duro esfuerzo, alcanzó la escarpada cima. Era la primera persona que coronaba en solitario la inalcanzable cúspide. Había sido un ascenso muy arriesgado, y quizá tenían razón los expertos que le habían aconsejado no elegir esa ruta para la subida, pero había valido la pena, pensó mientras contemplaba el magnífico paisaje desde la cumbre; así que, tras estudiar de nuevo el mapa, decidió emprender el descenso por el mismo trayecto. Sin embargo, al iniciar la bajada descubrió algo que no había visto durante el ascenso, algo inusitado: una preciosa aldea de casas de piedra y madera tallada parcialmente oculta bajo la montaña y camuflada entre la floresta. Cuando el escalador llegó a la entrada de la aldea sus habitantes salieron a su encuentro y le saludaron con una amable sonrisa de bienvenida y le invitaron a descansar y a una espléndida cena para festejar su proeza.
―Vuestro aspecto me dice que no sois de por aquí, sobre todo esos profundos ojos de tono indefinido que tenéis… ¿cómo es que vivís en esta aldea, en este recóndito lugar, tan cerca a la cima de la más inaccesible montaña de la gran cordillera? –les preguntó el escalador lleno de curiosidad durante la fiesta nocturna.
―Verás…, buscábamos un lugar seguro y apartado. Habíamos huido de nuestro hogar de origen porque nos perseguían y encontramos este lugar aislado y aquí nos instalamos y aquí llevamos viviendo desde entonces –le respondió el jefe de la aldea.
―¿Y desde cuándo vivís aquí?
―Llevamos aquí mucho tiempo… unos… 250 años… de los vuestros.
―¿De los nuestros…? Entonces… ¿de dónde sois?
―Del sistema Atasy, cerca de la nebulosa Eangi…, vivíamos en el planeta Tainn…. Somos lo que vosotros llamáis alienígenas.
―Ya… y tenéis la nave espacial guardada en el sótano, jajaja… por cierto… ¡este licor que me habéis dado es tremendo!… jajaja… y… ¿cómo es que me lo contáis, así, sin más?… –preguntó el escalador algo afectado por la bebida, siguiendo la broma, sin percatarse de la situación.
―Porque mantenemos viva la tradición de nuestros ancestros de decir siempre la verdad, y, además, sabemos que no se lo contarás a nadie –le respondió el jefe de la aldea… mientras le disparaba con su desmemorizador.
Y cuando el escalador bajó al puesto base contó la épica aventura que acababa de vivir, las dificultades que tuvo que solventar y el magnífico paisaje que había contemplado, pero sin la más mínima referencia a la singular aldea y a sus especiales aldeanos, que, en ese momento, reunidos en consejo, decidían que había llegado el momento de abandonar su, hasta ahora, seguro refugio y buscar un lugar mejor, pero en esta ocasión mezclándose entre los nativos humanos, aunque manteniendo en secreto, evidentemente, su procedencia estelar.

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

Cuentos sin importancia 201-Los aldeanos-PORTADA

 

________________________________________

• Haiku 415 – 419

Etiquetas

• Haiku 415 – 419

[415]

Mira el gusano
las escarpadas cimas;
desde una seta.

Mira el gusano las escarpadas cimas; desde una seta.

[416]

Vuela el gorrión
sin miedo a las alturas;
quiere ser águila.

Vuela el gorrión sin miedo a las alturas; quiere ser águila.

[417]

Mira, la luna
luce resplandeciente;
en noches negras.

Mira, la luna luce resplandeciente; en noches negras.

[418]

En lontananza
una estrella gigante;
simula un punto.

En lontananza una estrella gigante; simula un punto.

[419]

En medio de astros
aquella nebulosa;
una acuarela.

En medio de astros aquella nebulosa; una acuarela.

 

Luis J. Goróstegui
#haiku

________________________________________

• (Csi200) – Paraíso perdido.

Etiquetas

• (Csi200) – Paraíso perdido.

Ves campanas de papel que retumban más que el bruñido bronce y anuncian el comienzo de paseos enredados entre enmarañadas ramas de un viejo olivo olvidado; entre caminos interminables que confluyen en la roca tallada de insondable significado; bajo cataratas infinitas que nacen en algún manantial perdido entre enigmáticos bosques milenarios; intentando comprender viejas inscripciones encriptadas, pretéritos mensajes indescifrables cincelados en las paredes de negras cuevas habitadas por seres anónimos, o por fantasmas, o quizá por monstruos antediluvianos… De repente el eco de una lejana risa resuena en el valle y una joven de mirada anciana se acerca a ti y te dice: «Bienvenido, te esperábamos». Y te señala, con un gesto inabarcable de su mano, oculta entre las montañas, una insólita ciudad de aspecto arcano.
Y contemplas todo lo que te rodea y te sorprendes y ríes satisfecho y piensas que ha valido la pena el largo viaje hasta llegar a este remoto planeta, paraíso perdido entre nebulosas de colores y ese inconcebible cielo estrellado.

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

 

Cuentos sin importancia 200-Paraíso perdido

________________________________________

• (Csi199) – Ciencia de cuento de hadas.

Etiquetas

• (Csi199) – Ciencia de cuento de hadas.

Siempre había pensado que la ciencia y los cuentos de hadas eran incompatibles, antagónicos, como la materia y la antimateria; una tarde se lo comenté a mi padre y me sorprendió con esta inesperada respuesta: “Pero… ¿hay algo más de cuento de hadas que la antimateria?”
Como yo no acababa de tenerlo claro, mi padre me sugirió que analizara los cuentos de hadas con ojos de científico y los libros de ciencia con imaginación y fantasía.
―En todo buen cuento de hadas se ocultan principios físicos, reacciones químicas, paisajes geológicos o viajes en el tiempo y el espacio…
A partir de ese día comencé a ver los cuentos de hadas con otra perspectiva… pero sin embargo, lo más sorprendente me ocurrió una noche de verano: hacía mucho calor y no tenía sueño, así que cogí un libro de la librería, me senté en el sillón del salón, junto a la terraza, lo abrí y me puse a leerlo; al rato, ante mi asombro, un pequeño dragón escupefuego de brillantes escamas blancas salió volando de él. Creí soñar pero no, ¡era tan real!; tanto que de una bocanada prendió fuego al sillón donde estaba sentado. Lo apagué como pude y traté de atrapar al travieso dragón, pero no era capaz de volverlo a meter entre las páginas. Le agarré de las patas como pude y tiré de él, pero era más fuerte que yo y salió a la terraza y emprendió el vuelo; yo seguía agarrado a sus garras. Se elevó tanto que tuve vértigo y en un descuido me solté y caí desde lo alto. Mientras caía cerré los ojos… y entonces me di de narices con el suelo del salón de casa; me había quedado dormido y todo había sido un sueño… ¡un sueño tan real!…
Y lo curioso es que el libro que estaba leyendo era uno sobre física relativista… ¡para que después digan que la ciencia no es un cuento de hadas!, pensé mientras reía y me frotaba mi dolorida nariz.

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

Cuentos sin importancia 199-Ciencia de cuento de hadas

________________________________________

• Haiku 410 – 414

Etiquetas

• Haiku 410 – 414

[410]

El viento fluye
en la aurora boreal;
dibuja ríos.

El viento fluye en la aurora boreal; dibuja ríos.

[411]

Busca refugio
un enjambre de avispas;
en rosas blancas.

Busca refugio un enjambre de avispas; en rosas blancas.

[412]

Solaz estival
para desentumecer;
esa sonrisa.

Solaz estival para desentumecer; esa sonrisa.

[413]

Sin rumbo vuela
entre las nubes rojas;
golondrina azul.

Sin rumbo vuela entre las nubes rojas; golondrina azul.

[414]

Caza a solas
entre gardenias blancas;
la araña negra.

Caza a solas entre gardenias blancas; la araña negra.

Luis J. Goróstegui
#haiku

________________________________________

• (Csi198) – Juegos Olímpicos.

Etiquetas

• (Csi198) – Juegos Olímpicos.

Los participantes se sitúan en la línea de salida; suena la campana y se inicia la carrera. El número 3 toma la delantera aunque el 5 consigue igualarle, mientras el resto les persiguen con inusitado esfuerzo. Sin embargo, a media carrera, el número 4 esprinta de forma desconcertante y toma la delantera en dura riña con el número 1 que le empuja de forma descarada; el público abuchea. En el último tramo los cinco corredores se disputan heroicamente el triunfo. Finalmente el número 2 vence por medio cuerpo de ventaja; el público lo festeja.
―¡Cuidado, que viene! –avisa de repente un anciano de la primera fila del público.
―¡Rápido, recogedlos, que no los vea! –recomienda una mujer desde la segunda fila.
En eso una enfermera con aspecto de sargento de artillería se acerca con paso decidido.
―¡Otra vez!… ¡no les tengo dicho que están prohibidas las carreras clandestinas!… ¡y cuántas veces les he dicho que no se juega con la comida! –les regaña la enfermera de la residencia geriátrica mientras recoge a los cinco caracoles–; ¡denme el resto, son para la cena de esta noche!… y limpien la mesa de las babas de los corredores, ¿quieren?
Y la enfermera se marcha gruñendo algo ininteligible.
―¡Bien, ya se ha ido!… –dijo una adorable viejecita–, sacad los saltamontes para la prueba de salto de altura…, Juan, prepara el listón de altura… empezaremos con cinco centímetros…
Y es que de una cosa están todos seguros: después de lo que les ha costado reunir a los participantes, sobre todo a los esquivos saltamontes o los escurridizos pececitos del cercano río para las pruebas de natación, nadie les impedirá celebrar los Juegos Olímpicos.

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

Cuentos sin importancia 198-Juegos Olímpicos

________________________________________

• (Csi197) – Tormenta.

Etiquetas

• (Csi197) – Tormenta.

Son las doce pasadas de la noche y llueve a mares. Me asomo al balcón y el agua choca contra mi cara; me siento revivir. Un relámpago blanco me deslumbra a lo lejos –mi corazón se asombra–, y pocos segundos después retumba el cielo con un trueno inalcanzable; su sonido disminuye paulatinamente hasta desvanecerse como un azucarillo en el café del desayuno. Levanto la vista al negro cielo y me pierdo en la infinita oscuridad de la noche. Otro relámpago, otro trueno. Y otra vez otro relámpago y otro trueno. Es como si una orquesta interpretara una sinfonía tremenda, inconmensurable; como si el universo entero nos quisiera hacer saber de su insondable poder, de su infinita belleza. Otro relámpago, quizá un dragón; otro trueno, quizá su rugido; como si una lucha de titanes tuviera lugar más allá de las nubes. De repente el silencio: la tormenta cesa, los dragones duermen, ¿qué titán ganó la batalla?… ¡y nosotros los humanos que nos creemos los dueños del mundo!

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

Cuentos sin importancia 197-Tormenta

________________________________________

• Haiku 405 – 409

Etiquetas

• Haiku 405 – 409

[405]

Epifanía
al contemplar tu ser;
leve elocuencia.

Epifanía al contemplar tu ser; leve elocuencia.

[406]

En una cueva
un panal de miel dulce;
en el desierto.

En una cueva un panal de miel dulce; en el desierto.

[407]

Marea baja
que deja al descubierto
lo oculto.

Marea baja que deja al descubierto lo oculto.

[408]

Sólo unas flores
en vaso de bambú;
como una ofrenda.

Sólo unas flores en vaso de bambú; como una ofrenda.

[409]

Un cuadro viejo
como único recuerdo;
del presente.

Un cuadro viejo como único recuerdo; del presente.

Luis J. Goróstegui
#haiku

________________________________________

• (Csi196) – Una eternidad.

Etiquetas

• (Csi196) – Una eternidad.

Caminando por la ribera del río me encontré con un anciano de larga barba blanca, ojos claros y piel rugosa y morena que estaba sentado sobre las raíces de un frondoso árbol. Le saludé y me senté a su lado a descansar un rato. Charlamos sobre muchas cosas: me dijo que era escritor, aunque no me dijo su nombre; que vagaba por el mundo en busca de viejas historias olvidadas y, no sé muy bien cómo, acabamos hablando del tiempo y cómo pasa la vida sin que nos demos realmente cuenta.
―Y entonces… ¿cómo mide el tiempo? –le pregunté al hilo de la conversación.
―Por lo que escribo –me respondió con una sonrisa serena y algo enigmática.
Y como si recitara el fragmento de una antigua profecía continuó diciendo:
―…una palabra, un suspiro; un párrafo, todo un año; un cuento, una vida entera; un libro, mil años vividos; mil años, una vida; una vida, mil millones de años…
Dejó la frase sin terminar y permaneció en profundo silencio durante unos instantes como absorto, mirando al infinito.
―¿Qué edad tiene entonces, abuelo? –le pregunté con cariño.
―Una eternidad, hijo mío…, toda una eternidad.
Compartimos la comida que llevaba en mi mochila y cuando, poco después, me despedí de él me quedé con la impresión de que acababa de hablar con alguien excepcional, alguien realmente importante: como si Dios mismo hubiera bajado de nuevo al mundo para comprobar in situ cómo marchaba su obra.

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

Cuentos sin importancia 196-Una eternidad

________________________________________

• (Csi195) – Colonizadores.

Etiquetas

• (Csi195) – Colonizadores.

Hace mucho, en los bosques, se establecieron unos diminutos seres; llegaron a la Tierra procedentes de un lejano planeta, a bordo de una singular nave espacial aparentemente similar a un meteorito, y, tras milenios, evolucionaron hasta ser capaces de comunicarse telepáticamente entre sí. Los humanos no saben de nuestra existencia, o mejor dicho, sí lo saben aunque no nos consideran una amenaza, lo cual es una ventaja para nuestros propósitos colonizadores, porque simplemente… nos confunden con hormigas.

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

Cuentos sin importancia 195-Colonizadores

________________________________________

• Haiku 400 – 404

Etiquetas

• Haiku 400 – 404

[400]

Suena el arrullo
del agua de la fuente,
del cementerio.

Suena el arrullo del agua de la fuente, del cementerio.

[401]

¡Vuela pequeño!
no temas al temporal;
vendrá la calma.

¡Vuela pequeño! no temas al temporal; vendrá la calma.

[402]

No quiere el grillo
pasar inadvertido;
al anochecer.

No quiere el grillo pasar inadvertido; al anochecer.

[403]

Bebe la hormiga
la gota de rocío;
al amanecer.

Bebe la hormiga la gota de rocío; al amanecer.

[404]

Qué es un mago
con su varita mágica,
sino un escritor.

Qué es un mago con su varita mágica, sino un escritor.

Luis J. Goróstegui
#haiku

________________________________________

• (Csi194) – Érase otra vez.

Etiquetas

• (Csi194) – Érase otra vez.

Érase otra vez otra princesa que vivía en otro lejano lugar. Al amanecer de otra mañana de abril salió a pasear por el otro lago cuando otro dragón escupefuego la raptó y la llevó a su guarida secreta, en lo más profundo del otro bosque. La mañana siguiente, el rey se enteró de que su hija había sido secuestrada por un dragón y envió al príncipe azul para que la recatara. El príncipe llegó a la guarida, mató al dragón escupefuego y rescató a la princesa. Cuando regresaron, el rey, desconcertado, le dijo al príncipe:
―Agradezco que mataras al dragón escupefuego y salvaras a la princesa, comunicaré a su padre que su hija está sana y salva; pero he de informarte que la princesa, mi hija, sigue cautiva del dragón; porque tú has salvado a la otra princesa, la del otro reino en el otro bosque, así que, por favor, vuelve y rescata a mi hija, la princesa.
Y es que con tantos reinos, tantas princesas y tantos dragones ya no se sabe cuál es la princesa secuestrada a la que hay que rescatar de qué dragón.

©Luis Jesús Goróstegui Ubierna
@ObservaParaiso
#CuentosSinImportancia

Cuentos sin importancia 194-Érase otra vez

 

________________________________________